BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1805363.2.1
(2856 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY262821.1| Pinus radiata cellulose synthase (CesA2) mRN... 212 6e-053
gb|DR059426.1|DR059426 RTNIT1_17_D03.g1_A029 Roots minus ni... 200 2e-049
gb|AY262820.1| Pinus radiata cellulose synthase (CesA10) mR... 184 1e-044
gb|DR384721.1|DR384721 RTHG1_4_D04.b1_A029 Roots plus added... 168 8e-040
gb|BF778499.1|BF778499 NXSI_085_D12_F NXSI (Nsf Xylem Side ... 145 1e-032
gb|BQ196805.1|BQ196805 NXLV105_E07_F NXLV (Nsf Xylem Late w... 129 7e-028
gb|CO201610.1|CO201610 RTCNT2_7_A01.b1_A029 Root control 2 ... 129 7e-028
gb|CO369942.1|CO369942 RTK1_55_A04.g1_A029 Roots minus pota... 129 7e-028
dbj|BD236020.1| Materials and method for modification of pl... 119 7e-025
gb|AY639654.1| Pinus radiata cellulose synthase catalytic s... 119 7e-025
gb|AY789652.1| Pinus taeda cellulose synthase catalytic sub... 119 7e-025
gb|AL750979.1|AL750979 AL750979 RS Pinus pinaster cDNA clon... 107 3e-021
gb|DR017425.1|DR017425 STRS1_16_E10.b1_A034 Shoot tip pitch... 107 3e-021
gb|DR017506.1|DR017506 STRS1_16_E10.g1_A034 Shoot tip pitch... 107 3e-021
gb|DR744890.1|DR744890 RTCU1_25_C12.g1_A029 Roots plus adde... 107 3e-021
gb|AY262816.1| Pinus radiata cellulose synthase (CesA5) mRN... 107 3e-021
gb|AY262817.1| Pinus radiata cellulose synthase (CesA6) mRN... 107 3e-021
gb|AY262819.1| Pinus radiata cellulose synthase (CesA8) mRN... 107 3e-021
gb|DR020730.1|DR020730 STRS1_38_H10.g1_A034 Shoot tip pitch... 105 1e-020
gb|AY789651.1| Pinus taeda cellulose synthase catalytic sub... 105 1e-020
gb|AY262818.1| Pinus radiata cellulose synthase (CesA7) mRN... 105 1e-020
gb|BX784298.1|BX784298 BX784298 Pinus pinaster differenciat... 103 4e-020
gb|CF478017.1|CF478017 RTWW3_17_B06.g1_A022 Well-watered lo... 100 6e-019
gb|DR080401.1|DR080401 RTFEPL1_22_A02.g1_A029 Roots plus ad... 100 6e-019
gb|DR689610.1|DR689610 EST1079696 Normalized pine embryo li... 100 6e-019
gb|DT635390.1|DT635390 EST1150321 Normalized pine embryo li... 100 6e-019
dbj|BD235986.1| Materials and method for modification of pl... 100 6e-019
gb|BX249248.1|BX249248 BX249248 Pinus pinaster differenciat... 96 1e-017
gb|AW985306.1|AW985306 NXNV_135_F04_F Nsf Xylem Normal wood... 96 1e-017
gb|BF186257.1|BF186257 NXCI_135_B10_F NXCI (Nsf Xylem Compr... 96 1e-017
gb|CD019985.1|CD019985 NXNV008B03 Nsf Xylem Normal wood Ver... 92 2e-016
gb|CX647876.1|CX647876 COLD1_25_C03.b1_A029 Root cold Pinus... 88 2e-015
gb|AW697996.1|AW697996 NXNV_079_C07_F Nsf Xylem Normal wood... 84 4e-014
gb|BG039685.1|BG039685 NXSI_102_H08_F NXSI (Nsf Xylem Side ... 84 4e-014
gb|BQ695648.1|BQ695648 NXPV_030_H04_F NXPV (Nsf Xylem Plani... 84 4e-014
gb|BQ697774.1|BQ697774 NXPV_052_F10_F NXPV (Nsf Xylem Plani... 84 4e-014
gb|BQ703105.1|BQ703105 NXSI_136_D09_F NXSI (Nsf Xylem Side ... 84 4e-014
gb|DR060720.1|DR060720 RTNIT1_29_C08.g1_A029 Roots minus ni... 84 4e-014
gb|AH014290.1|SEG_AY764673S Pinus taeda isolate 11 cellulos... 84 4e-014
gb|AY764674.1|AY764673S2 Pinus taeda isolate 11 cellulose s... 84 4e-014
gb|AH014291.1|SEG_AY764675S Pinus taeda isolate 16 cellulos... 84 4e-014
gb|AY764676.1|AY764675S2 Pinus taeda isolate 16 cellulose s... 84 4e-014
gb|AH014292.1|SEG_AY764677S Pinus taeda isolate 25 cellulos... 84 4e-014
gb|AY764678.1|AY764677S2 Pinus taeda isolate 25 cellulose s... 84 4e-014
gb|AH014293.1|SEG_AY764679S Pinus taeda isolate 7 cellulose... 84 4e-014
gb|AY764680.1|AY764679S2 Pinus taeda isolate 7 cellulose sy... 84 4e-014
gb|AH014294.1|SEG_AY764681S Pinus taeda isolate 6 cellulose... 84 4e-014
gb|AY764682.1|AY764681S2 Pinus taeda isolate 6 cellulose sy... 84 4e-014
gb|AH014295.1|SEG_AY764683S Pinus taeda isolate 4 cellulose... 84 4e-014
gb|AY764684.1|AY764683S2 Pinus taeda isolate 4 cellulose sy... 84 4e-014
gb|AH014296.1|SEG_AY764685S Pinus taeda isolate 26 cellulos... 84 4e-014
gb|AY764686.1|AY764685S2 Pinus taeda isolate 26 cellulose s... 84 4e-014
gb|AH014297.1|SEG_AY764687S Pinus taeda isolate 9 cellulose... 84 4e-014
gb|AY764688.1|AY764687S2 Pinus taeda isolate 9 cellulose sy... 84 4e-014
gb|AH014298.1|SEG_AY764689S Pinus taeda isolate 23 cellulos... 84 4e-014
gb|AY764690.1|AY764689S2 Pinus taeda isolate 23 cellulose s... 84 4e-014
gb|AH014299.1|SEG_AY764691S Pinus taeda isolate 13 cellulos... 84 4e-014
gb|AY764692.1|AY764691S2 Pinus taeda isolate 13 cellulose s... 84 4e-014
gb|AH014300.1|SEG_AY764693S Pinus taeda isolate 30 cellulos... 84 4e-014
gb|AY764694.1|AY764693S2 Pinus taeda isolate 30 cellulose s... 84 4e-014
gb|AH014301.1|SEG_AY764695S Pinus taeda isolate 22 cellulos... 84 4e-014
gb|AY764696.1|AY764695S2 Pinus taeda isolate 22 cellulose s... 84 4e-014
gb|AH014302.1|SEG_AY764697S Pinus taeda isolate 32 cellulos... 84 4e-014
gb|AY764698.1|AY764697S2 Pinus taeda isolate 32 cellulose s... 84 4e-014
gb|AH014303.1|SEG_AY764699S Pinus taeda isolate 18 cellulos... 84 4e-014
gb|AY764700.1|AY764699S2 Pinus taeda isolate 18 cellulose s... 84 4e-014
gb|AH014304.1|SEG_AY764701S Pinus taeda isolate 10 cellulos... 84 4e-014
gb|AY764702.1|AY764701S2 Pinus taeda isolate 10 cellulose s... 84 4e-014
gb|AH014305.1|SEG_AY764703S Pinus taeda isolate 14 cellulos... 84 4e-014
gb|AY764704.1|AY764703S2 Pinus taeda isolate 14 cellulose s... 84 4e-014
gb|AH014306.1|SEG_AY764705S Pinus taeda isolate 21 cellulos... 84 4e-014
gb|AY764706.1|AY764705S2 Pinus taeda isolate 21 cellulose s... 84 4e-014
gb|AH014307.1|SEG_AY764707S Pinus taeda isolate 31 cellulos... 84 4e-014
gb|AY764708.1|AY764707S2 Pinus taeda isolate 31 cellulose s... 84 4e-014
gb|AH014308.1|SEG_AY764709S Pinus taeda isolate 5 cellulose... 84 4e-014
gb|AY764710.1|AY764709S2 Pinus taeda isolate 5 cellulose sy... 84 4e-014
gb|AH014309.1|SEG_AY764711S Pinus taeda isolate 2 cellulose... 84 4e-014
gb|AY764712.1|AY764711S2 Pinus taeda isolate 2 cellulose sy... 84 4e-014
gb|AH014310.1|SEG_AY764713S Pinus taeda isolate 3 cellulose... 84 4e-014
gb|AY764714.1|AY764713S2 Pinus taeda isolate 3 cellulose sy... 84 4e-014
gb|AH014311.1|SEG_AY764715S Pinus taeda isolate 19 cellulos... 84 4e-014
gb|AY764716.1|AY764715S2 Pinus taeda isolate 19 cellulose s... 84 4e-014
gb|AH014312.1|SEG_AY764717S Pinus taeda isolate 28 cellulos... 84 4e-014
gb|AY764718.1|AY764717S2 Pinus taeda isolate 28 cellulose s... 84 4e-014
gb|AH014313.1|SEG_AY764719S Pinus taeda isolate 17 cellulos... 84 4e-014
gb|AY764720.1|AY764719S2 Pinus taeda isolate 17 cellulose s... 84 4e-014
gb|AH014314.1|SEG_AY764721S Pinus taeda isolate 8 cellulose... 84 4e-014
gb|AY764722.1|AY764721S2 Pinus taeda isolate 8 cellulose sy... 84 4e-014
gb|AH014315.1|SEG_AY764723S Pinus taeda isolate 15 cellulos... 84 4e-014
gb|AY764724.1|AY764723S2 Pinus taeda isolate 15 cellulose s... 84 4e-014
gb|AH014316.1|SEG_AY764725S Pinus taeda isolate 1 cellulose... 84 4e-014
gb|AY764726.1|AY764725S2 Pinus taeda isolate 1 cellulose sy... 84 4e-014
gb|AH014317.1|SEG_AY764727S Pinus taeda isolate 29 cellulos... 84 4e-014
gb|AY764728.1|AY764727S2 Pinus taeda isolate 29 cellulose s... 84 4e-014
gb|AH014318.1|SEG_AY764729S Pinus taeda isolate 20 cellulos... 84 4e-014
gb|AY764730.1|AY764729S2 Pinus taeda isolate 20 cellulose s... 84 4e-014
gb|AH014320.1|SEG_AY764733S Pinus taeda isolate 12 cellulos... 84 4e-014
gb|AY764734.1|AY764733S2 Pinus taeda isolate 12 cellulose s... 84 4e-014
gb|AH014321.1|SEG_AY764735S Pinus taeda isolate 24 cellulos... 84 4e-014
gb|AY764736.1|AY764735S2 Pinus taeda isolate 24 cellulose s... 84 4e-014
gb|AA556746.1|AA556746 588 Loblolly pine NA Pinus taeda cDN... 82 1e-013
gb|BE187012.1|BE187012 NXNV_157_H10_F Nsf Xylem Normal wood... 82 1e-013
gb|BE657157.1|BE657157 NXCI_064_G04_F NXCI (Nsf Xylem Compr... 82 1e-013
gb|BE996873.1|BE996873 NXCI_103_E08_F NXCI (Nsf Xylem Compr... 82 1e-013
gb|BQ701215.1|BQ701215 NXSI_023_H05_F NXSI (Nsf Xylem Side ... 82 1e-013
gb|CD016846.1|CD016846 NXCI_064_H04_F NXCI (Nsf Xylem Compr... 82 1e-013
gb|CF672886.1|CF672886 RTCNT1_74_D05.g1_A029 Root control P... 82 1e-013
gb|CO169549.1|CO169549 NDL1_7_F09.g1_A029 Needles control P... 82 1e-013
gb|CX646526.1|CX646526 COLD1_9_H07.g1_A029 Root cold Pinus ... 82 1e-013
gb|DR054410.1|DR054410 RTCA1_17_D10.b1_A029 Roots minus cal... 82 1e-013
gb|DR110920.1|DR110920 RTS1_14_B08.b1_A029 Roots minus sulf... 82 1e-013
gb|DR118030.1|DR118030 RTMG1_10_E11.g1_A029 Roots minus mag... 82 1e-013
gb|DR163320.1|DR163320 RTFE1_42_F04.b1_A029 Roots minus iro... 82 1e-013
gb|DR686101.1|DR686101 EST1076179 Normalized pine embryo li... 82 1e-013
dbj|BD235989.1| Materials and method for modification of pl... 82 1e-013
gb|AY789650.1| Pinus taeda cellulose synthase catalytic sub... 82 1e-013
gb|AY262815.1| Pinus radiata cellulose synthase (CesA3) mRN... 82 1e-013
gb|BF778216.1|BF778216 NXSI_083_G10_F NXSI (Nsf Xylem Side ... 80 6e-013
gb|DR089385.1|DR089385 RTAL1_8_G12.b1_A029 Roots plus added... 80 6e-013
gb|DR682518.1|DR682518 EST1072593 Normalized pine embryo li... 80 6e-013
gb|AW056552.1|AW056552 ST51E06 Pine TriplEx shoot tip libra... 76 9e-012
gb|BX682714.1|BX682714 BX682714 Pinus pinaster differenciat... 76 9e-012
gb|AH014319.1|SEG_AY764731S Pinus taeda isolate 27 cellulos... 76 9e-012
gb|AY764732.1|AY764731S2 Pinus taeda isolate 27 cellulose s... 76 9e-012
gb|BX251307.1|BX251307 BX251307 Pinus pinaster differenciat... 72 1e-010
gb|AA556522.1|AA556522 377 Loblolly pine C Pinus taeda cDNA... 70 6e-010
gb|AA556640.1|AA556640 495 Loblolly pine C Pinus taeda cDNA... 68 2e-009
gb|BE762150.1|BE762150 NXCI_082_D03_F NXCI (Nsf Xylem Compr... 68 2e-009
gb|CD024597.1|CD024597 NXRV056_C03_F NXRV (Nsf Xylem Root w... 68 2e-009
gb|DR169086.1|DR169086 RTPHOS1_30_A02.b1_A029 Roots minus p... 68 2e-009
gb|CF478399.1|CF478399 RTWW3_18_G11.g1_A022 Well-watered lo... 66 9e-009
gb|AW698152.1|AW698152 NXNV_073_G04_F Nsf Xylem Normal wood... 64 3e-008
gb|CD020879.1|CD020879 NXNV_092_D05_F Nsf Xylem Normal wood... 64 3e-008
gb|CD027901.1|CD027901 NXNV_073_G04 Nsf Xylem Normal wood V... 64 3e-008
gb|BF169757.1|BF169757 NXCI_128_G07_F NXCI (Nsf Xylem Compr... 62 1e-007
gb|CD022890.1|CD022890 NXPV_089_B01_F NXPV (Nsf Xylem Plani... 62 1e-007
gb|DR059226.1|DR059226 RTNIT1_16_B01.g1_A029 Roots minus ni... 62 1e-007
gb|BQ695964.1|BQ695964 NXPV_034_H04_F NXPV (Nsf Xylem Plani... 60 5e-007
gb|BQ698119.1|BQ698119 NXPV_064_G05_F NXPV (Nsf Xylem Plani... 60 5e-007
gb|BQ698366.1|BQ698366 NXPV_069_A10_F NXPV (Nsf Xylem Plani... 60 5e-007
gb|CD023046.1|CD023046 NXPV_098_A07_F NXPV (Nsf Xylem Plani... 60 5e-007
gb|DR101934.1|DR101934 STRR1_76_G04.g1_A033 Stem Response R... 60 5e-007
gb|AW495797.1|AW495797 NXNV_065_E11_FF Nsf Xylem Normal woo... 58 2e-006
gb|BQ291066.1|BQ291066 NXRV055_C03_F NXRV (Nsf Xylem Root w... 58 2e-006
gb|CD027755.1|CD027755 NXNV_065_E11_F Nsf Xylem Normal wood... 58 2e-006
gb|CF668299.1|CF668299 RTCNT1_35_D11.g1_A029 Root control P... 58 2e-006
gb|CO369885.1|CO369885 RTK1_55_A04.b1_A029 Roots minus pota... 58 2e-006
gb|CV031645.1|CV031645 RTNACL1_2_G07.g1_A029 Roots plus add... 58 2e-006
gb|DR162195.1|DR162195 RTFE1_16_G12.b1_A029 Roots minus iro... 58 2e-006
gb|DR744391.1|DR744391 RTCU1_22_E01.b1_A029 Roots plus adde... 58 2e-006
gb|DR746030.1|DR746030 RTCU1_34_F01.b1_A029 Roots plus adde... 58 2e-006
gb|BF609349.1|BF609349 NXSI_045_C06_F NXSI (Nsf Xylem Side ... 56 8e-006
gb|BF777175.1|BF777175 NXSI_066_C05_F NXSI (Nsf Xylem Side ... 56 8e-006
gb|BF778225.1|BF778225 NXSI_083_H07_F NXSI (Nsf Xylem Side ... 56 8e-006
gb|BG275715.1|BG275715 NXSI_145_B01_F NXSI (Nsf Xylem Side ... 56 8e-006
gb|CD022200.1|CD022200 NXPV_024_F02_F NXPV (Nsf Xylem Plani... 56 8e-006
gb|CF396363.1|CF396363 RTDS2_21_F06.g1_A021 Drought-stresse... 56 8e-006
gb|CO369344.1|CO369344 RTK1_46_B01.g1_A029 Roots minus pota... 56 8e-006
gb|AW985238.1|AW985238 NXNV_132_G11_F Nsf Xylem Normal wood... 54 3e-005
gb|BE431393.1|BE431393 NXNV_181_F12_F Nsf Xylem Normal wood... 54 3e-005
gb|BV079715.1| Pp_CesA3 Pinus pinaster megagametophytes Pin... 54 3e-005
gb|AW011234.1|AW011234 ST18D02 Pine TriplEx shoot tip libra... 52 1e-004
gb|BF186171.1|BF186171 NXCI_133_H05_F NXCI (Nsf Xylem Compr... 52 1e-004
gb|BG275945.1|BG275945 NXSI_149_G12_F NXSI (Nsf Xylem Side ... 52 1e-004
gb|BQ698872.1|BQ698872 NXRV116_D12_F NXRV (Nsf Xylem Root w... 52 1e-004
gb|BQ700148.1|BQ700148 NXRV101_G08_F NXRV (Nsf Xylem Root w... 52 1e-004
gb|AY262814.1| Pinus radiata cellulose synthase (CesA11) mR... 52 1e-004
gb|AW870284.1|AW870284 NXNV_128_H04_F Nsf Xylem Normal wood... 50 5e-004
gb|BE209216.1|BE209216 NXNV_147_D10_F Nsf Xylem Normal wood... 50 5e-004
gb|BM493879.1|BM493879 NXLV_071_A06_F NXLV (Nsf Xylem Late ... 50 5e-004
gb|CF478733.1|CF478733 RTWW3_16_G10.g1_A022 Well-watered lo... 50 5e-004
gb|DR096386.1|DR096386 STRR1_27_D08.g1_A033 Stem Response R... 50 5e-004
gb|AW290811.1|AW290811 NXNV047B05F Nsf Xylem Normal wood Ve... 48 0.002
gb|CD027470.1|CD027470 NXNV047B05 Nsf Xylem Normal wood Ver... 48 0.002
gb|DR687054.1|DR687054 EST1077132 Normalized pine embryo li... 48 0.002
gb|DT633819.1|DT633819 EST1148750 Normalized pine embryo li... 48 0.002
gb|AW289733.1|AW289733 NXNV005B08F Nsf Xylem Normal wood Ve... 46 0.008
gb|BX000643.1|BX000643 BX000643 Pinus pinaster xylem Pinus ... 46 0.008
gb|BF516632.1|BF516632 NXSI_001_D01_F NXSI (Nsf Xylem Side ... 46 0.008
gb|BG317558.1|BG317558 NXPV_003_B08_F NXPV (Nsf Xylem Plani... 46 0.008
gb|BI202889.1|BI202889 NXPV_091_H09_F NXPV (Nsf Xylem Plani... 46 0.008
gb|CD021726.1|CD021726 NXNV_159_F12_F Nsf Xylem Normal wood... 46 0.008
gb|CD028293.1|CD028293 NXNV005B08 Nsf Xylem Normal wood Ver... 46 0.008
gb|DR163407.1|DR163407 RTFE1_42_F04.g1_A029 Roots minus iro... 46 0.008
gb|DR695127.1|DR695127 EST1085220 Normalized pine embryo li... 46 0.008
gb|BV079717.1| Pp_CesA7 Pinus pinaster megagametophytes Pin... 46 0.008
gb|BF517368.1|BF517368 NXSI_013_F11_F NXSI (Nsf Xylem Side ... 44 0.032
gb|BF609760.1|BF609760 NXSI_050_B03_F NXSI (Nsf Xylem Side ... 44 0.032
gb|DR118589.1|DR118589 RTMG1_18_A07.b1_A029 Roots minus mag... 44 0.032
gb|AY764673.1|AY764673S1 Pinus taeda isolate 11 cellulose s... 44 0.032
gb|AY764675.1|AY764675S1 Pinus taeda isolate 16 cellulose s... 44 0.032
gb|AY764677.1|AY764677S1 Pinus taeda isolate 25 cellulose s... 44 0.032
gb|AY764679.1|AY764679S1 Pinus taeda isolate 7 cellulose sy... 44 0.032
gb|AY764681.1|AY764681S1 Pinus taeda isolate 6 cellulose sy... 44 0.032
gb|AY764683.1|AY764683S1 Pinus taeda isolate 4 cellulose sy... 44 0.032
gb|AY764685.1|AY764685S1 Pinus taeda isolate 26 cellulose s... 44 0.032
gb|AY764687.1|AY764687S1 Pinus taeda isolate 9 cellulose sy... 44 0.032
gb|AY764689.1|AY764689S1 Pinus taeda isolate 23 cellulose s... 44 0.032
gb|AY764691.1|AY764691S1 Pinus taeda isolate 13 cellulose s... 44 0.032
gb|AY764693.1|AY764693S1 Pinus taeda isolate 30 cellulose s... 44 0.032
gb|AY764695.1|AY764695S1 Pinus taeda isolate 22 cellulose s... 44 0.032
gb|AY764697.1|AY764697S1 Pinus taeda isolate 32 cellulose s... 44 0.032
gb|AY764699.1|AY764699S1 Pinus taeda isolate 18 cellulose s... 44 0.032
gb|AY764701.1|AY764701S1 Pinus taeda isolate 10 cellulose s... 44 0.032
gb|AY764703.1|AY764703S1 Pinus taeda isolate 14 cellulose s... 44 0.032
gb|AY764705.1|AY764705S1 Pinus taeda isolate 21 cellulose s... 44 0.032
gb|AY764707.1|AY764707S1 Pinus taeda isolate 31 cellulose s... 44 0.032
gb|AY764709.1|AY764709S1 Pinus taeda isolate 5 cellulose sy... 44 0.032
gb|AY764711.1|AY764711S1 Pinus taeda isolate 2 cellulose sy... 44 0.032
gb|AY764713.1|AY764713S1 Pinus taeda isolate 3 cellulose sy... 44 0.032
gb|AY764715.1|AY764715S1 Pinus taeda isolate 19 cellulose s... 44 0.032
gb|AY764717.1|AY764717S1 Pinus taeda isolate 28 cellulose s... 44 0.032
gb|AY764719.1|AY764719S1 Pinus taeda isolate 17 cellulose s... 44 0.032
gb|AY764721.1|AY764721S1 Pinus taeda isolate 8 cellulose sy... 44 0.032
gb|AY764723.1|AY764723S1 Pinus taeda isolate 15 cellulose s... 44 0.032
gb|AY764725.1|AY764725S1 Pinus taeda isolate 1 cellulose sy... 44 0.032
gb|AY764727.1|AY764727S1 Pinus taeda isolate 29 cellulose s... 44 0.032
gb|AY764729.1|AY764729S1 Pinus taeda isolate 20 cellulose s... 44 0.032
gb|AY764731.1|AY764731S1 Pinus taeda isolate 27 cellulose s... 44 0.032
gb|AY764733.1|AY764733S1 Pinus taeda isolate 12 cellulose s... 44 0.032
gb|AY764735.1|AY764735S1 Pinus taeda isolate 24 cellulose s... 44 0.032
gb|AW289623.1|AW289623 NXNV003H02F Nsf Xylem Normal wood Ve... 42 0.12
gb|BX249614.1|BX249614 BX249614 Pinus pinaster differenciat... 42 0.12
gb|BX250234.1|BX250234 BX250234 Pinus pinaster differenciat... 42 0.12
gb|BX250396.1|BX250396 BX250396 Pinus pinaster differenciat... 42 0.12
gb|BX252761.1|BX252761 BX252761 Pinus pinaster differenciat... 42 0.12
gb|BX254022.1|BX254022 BX254022 Pinus pinaster differenciat... 42 0.12
gb|BX254483.1|BX254483 BX254483 Pinus pinaster differenciat... 42 0.12
gb|BX254948.1|BX254948 BX254948 Pinus pinaster differenciat... 42 0.12
gb|BX255349.1|BX255349 BX255349 Pinus pinaster differenciat... 42 0.12
gb|BX255542.1|BX255542 BX255542 Pinus pinaster differenciat... 42 0.12
gb|BE643725.1|BE643725 NXCI_043_H03_F NXCI (Nsf Xylem Compr... 42 0.12
gb|BE643804.1|BE643804 NXCI_047_D12_F NXCI (Nsf Xylem Compr... 42 0.12
gb|CD028231.1|CD028231 NXNV003H02 Nsf Xylem Normal wood Ver... 42 0.12
gb|DR110657.1|DR110657 RTS1_12_E03.b1_A029 Roots minus sulf... 42 0.12
gb|DR110744.1|DR110744 RTS1_12_E03.g1_A029 Roots minus sulf... 42 0.12
gb|AW290647.1|AW290647 NXNV044E04F Nsf Xylem Normal wood Ve... 40 0.49
gb|AW698302.1|AW698302 NXNV_071_E11_F Nsf Xylem Normal wood... 40 0.49
gb|AW784057.1|AW784057 NXNV_117_B10_F Nsf Xylem Normal wood... 40 0.49
gb|BE123803.1|BE123803 NXNV_156_F02_F Nsf Xylem Normal wood... 40 0.49
gb|BE451860.1|BE451860 NXCI_004_B09_F NXCI (Nsf Xylem Compr... 40 0.49
gb|BF220717.1|BF220717 NXCI_149_G02_F NXCI (Nsf Xylem Compr... 40 0.49
gb|BF221043.1|BF221043 NXCI_162_E11_F NXCI (Nsf Xylem Compr... 40 0.49
gb|BG673833.1|BG673833 NXPV_075_F11_F NXPV (Nsf Xylem Plani... 40 0.49
gb|CD027309.1|CD027309 NXNV044E04 Nsf Xylem Normal wood Ver... 40 0.49
gb|CF390276.1|CF390276 RTDR2_18_A03.g1_A021 Loblolly pine r... 40 0.49
gb|DR100267.1|DR100267 STRR1_62_H11.g1_A033 Stem Response R... 40 0.49
gb|DR160218.1|DR160218 RTFE1_4_D09.g1_A029 Roots minus iron... 40 0.49
gb|DR684943.1|DR684943 EST1075020 Normalized pine embryo li... 40 0.49
gb|DT632612.1|DT632612 EST1147543 Normalized pine embryo li... 40 0.49
gb|DT638876.1|DT638876 EST1153807 Normalized pine embryo li... 40 0.49
gb|AA739644.1|AA739644 409 PtIFG2 Pinus taeda cDNA clone 86... 38 1.9
gb|AI724974.1|AI724974 873 PtIFG2 Pinus taeda cDNA clone 86... 38 1.9
gb|AW010875.1|AW010875 ST12E01 Pine TriplEx shoot tip libra... 38 1.9
gb|BG040950.1|BG040950 NXSI_117_A06_F NXSI (Nsf Xylem Side ... 38 1.9
gb|BX679126.1|BX679126 BX679126 RS Pinus pinaster cDNA clon... 38 1.9
gb|CO175094.1|CO175094 NDL1_48_H01.b1_A029 Needles control ... 38 1.9
gb|DR049623.1|DR049623 RTBOR1_18_A06.b1_A029 Roots plus add... 38 1.9
gb|DR096307.1|DR096307 STRR1_27_D08.b1_A033 Stem Response R... 38 1.9
gb|DR691891.1|DR691891 EST1081978 Normalized pine embryo li... 38 1.9
dbj|BD235988.1| Materials and method for modification of pl... 38 1.9
gb|AA739991.1|AA739991 756 PtIFG2 Pinus taeda cDNA clone 92... 36 7.7
gb|AI812887.1|AI812887 22B3 Pine Lambda Zap Xylem library P... 36 7.7
gb|BX252351.1|BX252351 BX252351 Pinus pinaster differenciat... 36 7.7
gb|AW698053.1|AW698053 NXNV_072_F12_F Nsf Xylem Normal wood... 36 7.7
gb|BE209203.1|BE209203 NXNV_147_C08_F Nsf Xylem Normal wood... 36 7.7
gb|BE457983.1|BE457983 NXCI_008_H12_F NXCI (Nsf Xylem Compr... 36 7.7
gb|BE520100.1|BE520100 NXCI_016_G11_F NXCI (Nsf Xylem Compr... 36 7.7
gb|BE656835.1|BE656835 NXCI_040_B06_F NXCI (Nsf Xylem Compr... 36 7.7
gb|BF010934.1|BF010934 NXCI_094_H06_F NXCI (Nsf Xylem Compr... 36 7.7
gb|BF610475.1|BF610475 NXSI_058_H08_F NXSI (Nsf Xylem Side ... 36 7.7
gb|BF610612.1|BF610612 NXSI_060_G02_F NXSI (Nsf Xylem Side ... 36 7.7
gb|BG039408.1|BG039408 NXSI_098_F10_F NXSI (Nsf Xylem Side ... 36 7.7
gb|BG318985.1|BG318985 NXPV_022_C01_F NXPV (Nsf Xylem Plani... 36 7.7
gb|BQ290618.1|BQ290618 NXRV047_E08_F NXRV (Nsf Xylem Root w... 36 7.7
gb|BQ655583.1|BQ655583 NXRV096_E02_F NXRV (Nsf Xylem Root w... 36 7.7
gb|BQ702475.1|BQ702475 NXSI_129_A10_F NXSI (Nsf Xylem Side ... 36 7.7
gb|BQ702504.1|BQ702504 NXSI_129_D04_F NXSI (Nsf Xylem Side ... 36 7.7
gb|CD017522.1|CD017522 NXCI_124_B01_F NXCI (Nsf Xylem Compr... 36 7.7
gb|CD028487.1|CD028487 NXSI_119_E10_F NXSI (Nsf Xylem Side ... 36 7.7
gb|CF388887.1|CF388887 RTDR2_16_F12.b1_A021 Loblolly pine r... 36 7.7
gb|CF388926.1|CF388926 RTDR2_16_F12.g1_A021 Loblolly pine r... 36 7.7
gb|CF391624.1|CF391624 RTDR3_11_A02.b1_A022 Loblolly pine r... 36 7.7
gb|CF394346.1|CF394346 RTDS2_5_E03.b1_A021 Drought-stressed... 36 7.7
gb|CF477042.1|CF477042 RTWW3_5_B04.b1_A022 Well-watered lob... 36 7.7
gb|CF477096.1|CF477096 RTWW3_5_B04.g1_A022 Well-watered lob... 36 7.7
gb|CF666095.1|CF666095 RTCNT1_20_E07.g1_A029 Root control P... 36 7.7
gb|CO160156.1|CO160156 FLD1_19_C12.b1_A029 Root flooded Pin... 36 7.7
gb|CO160226.1|CO160226 FLD1_19_C12.g1_A029 Root flooded Pin... 36 7.7
gb|CO161218.1|CO161218 FLD1_27_H07.b1_A029 Root flooded Pin... 36 7.7
gb|CO161295.1|CO161295 FLD1_27_H07.g1_A029 Root flooded Pin... 36 7.7
gb|CO168623.1|CO168623 NDL1_1_A02.g1_A029 Needles control P... 36 7.7
gb|CO168720.1|CO168720 NDL1_2_C06.b1_A029 Needles control P... 36 7.7
gb|CO168792.1|CO168792 NDL1_2_C06.g1_A029 Needles control P... 36 7.7
gb|CO364835.1|CO364835 RTK1_22_C07.b1_A029 Roots minus pota... 36 7.7
gb|CO364916.1|CO364916 RTK1_22_C07.g1_A029 Roots minus pota... 36 7.7
gb|CO368104.1|CO368104 RTK1_38_D10.g1_A029 Roots minus pota... 36 7.7
gb|CO369260.1|CO369260 RTK1_46_B01.b1_A029 Roots minus pota... 36 7.7
gb|CO369625.1|CO369625 RTK1_48_H07.b1_A029 Roots minus pota... 36 7.7
gb|CO369706.1|CO369706 RTK1_48_H07.g1_A029 Roots minus pota... 36 7.7
gb|CO370493.1|CO370493 RTK1_68_F02.b1_A029 Roots minus pota... 36 7.7
gb|CO370570.1|CO370570 RTK1_68_F02.g1_A029 Roots minus pota... 36 7.7
gb|CV032449.1|CV032449 RTNACL1_8_F06.b1_A029 Roots plus add... 36 7.7
gb|CV032527.1|CV032527 RTNACL1_8_F06.g1_A029 Roots plus add... 36 7.7
gb|CV033866.1|CV033866 RTNACL1_37_C08.b1_A029 Roots plus ad... 36 7.7
gb|CV033945.1|CV033945 RTNACL1_37_C08.g1_A029 Roots plus ad... 36 7.7
gb|CX646246.1|CX646246 COLD1_8_E08.b1_A029 Root cold Pinus ... 36 7.7
gb|CX646332.1|CX646332 COLD1_8_E08.g1_A029 Root cold Pinus ... 36 7.7
gb|DN629236.1|DN629236 EST980052 Subtracted pine embryo lib... 36 7.7
gb|DN631958.1|DN631958 EST982774 Subtracted pine embryo lib... 36 7.7
gb|DN634526.1|DN634526 EST985342 Subtracted pine embryo lib... 36 7.7
gb|DR014509.1|DR014509 HEAT1_50_A01.b1_A029 Root at 37 C fo... 36 7.7
gb|DR014588.1|DR014588 HEAT1_50_A01.g1_A029 Root at 37 C fo... 36 7.7
gb|DR018316.1|DR018316 STRS1_22_B11.b1_A034 Shoot tip pitch... 36 7.7
gb|DR018379.1|DR018379 STRS1_22_B11.g1_A034 Shoot tip pitch... 36 7.7
gb|DR019218.1|DR019218 STRS1_28_C03.g1_A034 Shoot tip pitch... 36 7.7
gb|DR022649.1|DR022649 STRS1_52_B09.g1_A034 Shoot tip pitch... 36 7.7
gb|DR051634.1|DR051634 RTBOR1_31_H05.b1_A029 Roots plus add... 36 7.7
gb|DR052871.1|DR052871 RTCA1_7_A07.g1_A029 Roots minus calc... 36 7.7
gb|DR053416.1|DR053416 RTCA1_11_A08.b1_A029 Roots minus cal... 36 7.7
gb|DR053483.1|DR053483 RTCA1_11_A08.g1_A029 Roots minus cal... 36 7.7
gb|DR057508.1|DR057508 RTNIT1_6_E11.b1_A029 Roots minus nit... 36 7.7
gb|DR057597.1|DR057597 RTNIT1_6_E11.g1_A029 Roots minus nit... 36 7.7
gb|DR069916.1|DR069916 RTDK1_10_E04.b1_A029 Roots, dark Pin... 36 7.7
gb|DR070002.1|DR070002 RTDK1_10_E04.g1_A029 Roots, dark Pin... 36 7.7
gb|DR078662.1|DR078662 RTFEPL1_6_C09.b1_A029 Roots plus add... 36 7.7
gb|DR080106.1|DR080106 RTFEPL1_20_G01.b1_A029 Roots plus ad... 36 7.7
gb|DR080778.1|DR080778 RTFEPL1_25_D09.b1_A029 Roots plus ad... 36 7.7
gb|DR089389.1|DR089389 RTAL1_8_H04.b1_A029 Roots plus added... 36 7.7
gb|DR089465.1|DR089465 RTAL1_8_G12.g1_A029 Roots plus added... 36 7.7
gb|DR093719.1|DR093719 STRR1_10_B05.b1_A033 Stem Response R... 36 7.7
gb|DR097063.1|DR097063 STRR1_32_F04.b1_A033 Stem Response R... 36 7.7
gb|DR097134.1|DR097134 STRR1_32_F04.g1_A033 Stem Response R... 36 7.7
gb|DR102505.1|DR102505 STRR1_81_D01.g1_A033 Stem Response R... 36 7.7
gb|DR102795.1|DR102795 STRR1_84_A05.b1_A033 Stem Response R... 36 7.7
gb|DR102842.1|DR102842 STRR1_84_A05.g1_A033 Stem Response R... 36 7.7
gb|DR387221.1|DR387221 RTHG1_20_G03.b1_A029 Roots plus adde... 36 7.7
gb|DR387297.1|DR387297 RTHG1_20_G03.g1_A029 Roots plus adde... 36 7.7
gb|DR388242.1|DR388242 RTHG1_27_B03.b1_A029 Roots plus adde... 36 7.7
gb|DR388315.1|DR388315 RTHG1_27_B03.g1_A029 Roots plus adde... 36 7.7
gb|DT635816.1|DT635816 EST1150747 Normalized pine embryo li... 36 7.7
>gb|AY262821.1| Pinus radiata cellulose synthase (CesA2) mRNA, partial cds
Length = 3603
Score = 212 bits (107), Expect = 6e-053
Identities = 501/633 (79%)
Strand = Plus / Minus
Query: 2005 attcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacata 2064
|||||| ||||| || ||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 1581 attcatagcaccggctttcttgtggtgttggaagccaggcctcttttcacgagacacata 1522
Query: 2065 aacaagccgtggcaactcattcccatccgtgtcaagcccaccactgtggcccaagaatac 2124
|| || ||||| | ||||| || || || || | ||| |||||||| || || || ||
Sbjct: 1521 gactagacgtggtagttcattgccttcagtatccatccctccactgtgtcctaaaaacac 1462
Query: 2125 ttggatcattccnggatgatctctagggttattcccaggccanggagtgccatcagccat 2184
|| ||||| || ||||| || || | ||||| |||||||| ||||||||||| |||
Sbjct: 1461 ctgtatcatcccaggatggtccctggtattatttccaggccagggagtgccatcttgcat 1402
Query: 2185 ggtccagccctcctcaggtattttttgcgcttttgcaacaagggcatcgatccgtacttt 2244
||||||||| ||||||| || || || || |||||||| |||| |||||| || ||
Sbjct: 1401 aacccagccctcttcaggtaccttctgggccttcgcaacaagcgcattgatccgaacctt 1342
Query: 2245 gaactcttcatactccctcttcatagcccgcctttctttcacaaaagaaggttgtatttt 2304
||| |||||||| || |||||||| |||| || ||||| ||||||| ||| |||| |||
Sbjct: 1341 gaattcttcatattctctcttcattgccctccgctcttttacaaaagtaggctgtacttt 1282
Query: 2305 gtcctttaggtaatctatctttcgagcaaagtaaaactctggagccctaggttcaatgtt 2364
|||||| | |||||| || || | | ||||| |||||||||| || |||||||||||
Sbjct: 1281 gtccttcaagtaatccattttcagtgagaagtaccactctggagctctgggttcaatgtt 1222
Query: 2365 gtgtttcttgcaaaagggaacccatttccttgcaaactctgcggtttcagatagagcttc 2424
|| |||||||| || ||||||||||||||||| |||| ||||| || || | |||
Sbjct: 1221 aaactttttgcaaaatggcacccatttccttgcaaattctgaagtttctgaaagggattc 1162
Query: 2425 aaaagtcaacatagctgaaccgtcatcagaaacataacatgatactttgtcaacagggta 2484
||||||||||| |||| || || ||||||||||| || || || ||||||||||| ||
Sbjct: 1161 gaaagtcaacatggctgctccatcgtcagaaacatagcaggaaaccttgtcaacaggata 1102
Query: 2485 atccacagcaagaatggacaggacagtgttgccagtaattagaggaggttccttaagtgg 2544
|||||||| ||||| ||||| |||||||| |||||| |||||||| ||||| | ||
Sbjct: 1101 atccacagacagaatcgacagaacagtgtttgcagtaacaagaggaggctcctttaaagg 1042
Query: 2545 atccactgtactaacaaagacatcgattggagccaactgggatggctcaccctccctatc 2604
|| |||||||| ||||| | || || | ||||||||| ||||| ||||| || | ||
Sbjct: 1041 gtcaactgtactgacaaaaatgtcaatagcagccaactgtgatggttcaccttctcggtc 982
Query: 2605 atatctcaatgcaagtctatcgaggtaagtttc 2637
||||||||| ||||| || || ||||| |||||
Sbjct: 981 atatctcaaagcaagcctgtcaaggtatgtttc 949
Score = 91.7 bits (46), Expect = 2e-016
Identities = 229/290 (78%)
Strand = Plus / Minus
Query: 1030 gggatagatgtaattggataaacaatggtgttgatgtatgccagtctctccagaagcttt 1089
|||||||| || || |||||||| | ||||| |||||||| || |||||||| ||
Sbjct: 2552 gggatagaagtgatgggataaactgtagtgtttatgtatgctagcctctccagccatttc 2493
Query: 1090 agccttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaa 1149
||||||||| ||||||||||| || || || || | ||| || ||||||||||| |||
Sbjct: 2492 agccttccaccataaccataccaaattgggcaatgacggctgagaagaatttcaacagaa 2433
Query: 1150 ccaagagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaaccc 1209
|| | ||||| || | |||||||| | ||||||||||||||| || |||||||| ||
Sbjct: 2432 cccaatgcccatcgaagtacttggttcaaacgatcagaaagatttataggagcagaccct 2373
Query: 1210 ttgaagcaaggccgaagtggcatgcagtagatggatatccaacctcttgcatgcatcttg 1269
||||| ||| ||| | ||||||||||| |||||| |||| || | |||||||| ||
Sbjct: 2372 ttgaatgcagggcgaggaggcatgcagtaaatggatctccagccacgagcatgcatttta 2313
Query: 1270 aaaccagttaaaatatcttcagtaacagagccatatatccatccgatctc 1319
|| ||||||||||||||||| || || || ||||| ||||| || |||||
Sbjct: 2312 aatccagttaaaatatcttccgtcactgaaccataaatccaaccaatctc 2263
Score = 58.0 bits (29), Expect = 2e-006
Identities = 155/197 (78%)
Strand = Plus / Minus
Query: 697 gtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcctttgatgtg 756
||||| ||||||| ||||| ||| |||||||| || || ||||| | || || ||||||
Sbjct: 2885 gtccatttgaacagatacaactctgcaaaatctccgtcttcatctgaagctttcgatgtg 2826
Query: 757 accgtgaagtttgtgtcgatccctgctagcacttttaagagaccttggaacacagcaaag 816
|| |||||||||||||| || || || || ||||| | | || |||| || ||||||
Sbjct: 2825 acagtgaagtttgtgtcaataccggcaaggactttcagcaacccctggacgactgcaaag 2766
Query: 817 agatgtgcagaggtgccaccaatgacccaaaactgctcatttctccaccaatcctcaatg 876
||||| || || || ||||||||||| || || ||||| |||||||| || |||||
Sbjct: 2765 agatgagctgacacacctccaatgacccagaattgttcattcctccaccattcatcaata 2706
Query: 877 ccaacaccactccatcg 893
||||| |||||||||||
Sbjct: 2705 ccaaccccactccatcg 2689
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 1717 cctattgaaacagcatcctgttcccacataaac 1749
|||||||||||| |||||||| |||||||||||
Sbjct: 1869 cctattgaaacaacatcctgtacccacataaac 1837
Score = 44.1 bits (22), Expect = 0.032
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 1477 tttctccaagctcttctgagacataagcag 1506
|||||| ||||||||||||||||| |||||
Sbjct: 2118 tttctctaagctcttctgagacatgagcag 2089
Score = 38.2 bits (19), Expect = 1.9
Identities = 34/39 (87%)
Strand = Plus / Minus
Query: 1525 accttcaaatccctcttctatatcttccatgttgaagat 1563
|||||||| || |||||||||||||||| ||||||||
Sbjct: 2064 accttcaacgccttcttctatatcttccagattgaagat 2026
Score = 36.2 bits (18), Expect = 7.7
Identities = 57/70 (81%)
Strand = Plus / Minus
Query: 535 ttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaatagt 594
|||||||||||||| || |||| |||||||| | ||||| || || || ||||| ||
Sbjct: 3047 ttcaggaaagggtaaagatggacaatcacccaaaacgcaaaaaagagttttccgaacagg 2988
Query: 595 ggaccccatg 604
||||||||||
Sbjct: 2987 ggaccccatg 2978
>gb|DR059426.1|DR059426 RTNIT1_17_D03.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_17_D03_A029 5', mRNA sequence
Length = 862
Score = 200 bits (101), Expect = 2e-049
Identities = 468/591 (79%)
Strand = Plus / Minus
Query: 2005 attcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacata 2064
|||||| ||||| || ||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 647 attcatagcaccggctttcttgtggtgttggaagccaggcctcttttcacgagacacata 588
Query: 2065 aacaagccgtggcaactcattcccatccgtgtcaagcccaccactgtggcccaagaatac 2124
|| || ||||| | ||||| || || || || | ||| |||||||| || || || ||
Sbjct: 587 gactagacgtggtagttcattgccttcagtatccatccctccactgtgtcctaaaaacac 528
Query: 2125 ttggatcattccnggatgatctctagggttattcccaggccanggagtgccatcagccat 2184
|| ||||| || ||||| || || | ||||| |||||||| |||||||||| |||
Sbjct: 527 ctgtatcatcccaggatggtccctggtattatttccaggccagagagtgccatcttgcat 468
Query: 2185 ggtccagccctcctcaggtattttttgcgcttttgcaacaagggcatcgatccgtacttt 2244
||||||||| ||||||| || || || || |||||||| |||| |||||| || ||
Sbjct: 467 aacccagccctcttcaggtaccttctgggccttcgcaacaagcgcattgatccgaacctt 408
Query: 2245 gaactcttcatactccctcttcatagcccgcctttctttcacaaaagaaggttgtatttt 2304
||| |||||||| || |||||||| |||| || ||||| ||||||| ||| |||| |||
Sbjct: 407 gaattcttcatattctctcttcattgccctccgctcttttacaaaagtaggctgtacttt 348
Query: 2305 gtcctttaggtaatctatctttcgagcaaagtaaaactctggagccctaggttcaatgtt 2364
|||||| | |||||| || || | | |||||| |||||||||| || |||||||||||
Sbjct: 347 gtccttcaagtaatccattttcagtgaaaagtaccactctggagctctgggttcaatgtt 288
Query: 2365 gtgtttcttgcaaaagggaacccatttccttgcaaactctgcggtttcagatagagcttc 2424
|| |||||||| || ||||||||||||||||| |||| ||||| || || | |||
Sbjct: 287 aaactttttgcaaaatggcacccatttccttgcaaattctgaagtttctgaaagggattc 228
Query: 2425 aaaagtcaacatagctgaaccgtcatcagaaacataacatgatactttgtcaacagggta 2484
||||||||||| |||| || || ||||||||||| || || || ||||||||||| ||
Sbjct: 227 gaaagtcaacatggctgctccatcgtcagaaacatagcaggaaaccttgtcaacaggata 168
Query: 2485 atccacagcaagaatggacaggacagtgttgccagtaattagaggaggttccttaagtgg 2544
|||||||| ||||| ||||| |||||||| |||||| |||||||| ||||| | ||
Sbjct: 167 atccacagacagaatcgacagaacagtgtttgcagtaacaagaggaggctcctttaaagg 108
Query: 2545 atccactgtactaacaaagacatcgattggagccaactgggatggctcacc 2595
|| |||||||| ||||| | || || | ||||||||| ||||| |||||
Sbjct: 107 gtcaactgtactgacaaaaatgtcaatagcagccaactgtgatggttcacc 57
>gb|AY262820.1| Pinus radiata cellulose synthase (CesA10) mRNA, complete cds
Length = 4428
Score = 184 bits (93), Expect = 1e-044
Identities = 697/899 (77%)
Strand = Plus / Minus
Query: 1715 tgcctattgaaacagcatcctgttcccacataaacaggtccttgaatgccatctagaccc 1774
||||| |||||| ||| ||||| |||||||||||||| || || || ||||| | ||||
Sbjct: 2624 tgcctgttgaaaacgcaccctgtgcccacataaacaggcccctgtatcccatccaaaccc 2565
Query: 1775 ttcatattaatatcaaagaagacaatgttccggtttgcatatcgatcatgcaagtctata 1834
|||| ||| |||||||| ||||| | || | || ||||||||||||| ||| ||
Sbjct: 2564 ttcaaattgatatcaaaaaagactgtattgtgattagcatatcgatcatttctgtcaatg 2505
Query: 1835 ccatcaaatctttgtggaaactgaacatagcaagttttccttcctagtgctggatccatc 1894
|||||||| ||||| || ||||||||||| || |||| | || || | |||||||||
Sbjct: 2504 ccatcaaacctttgagggaactgaacataacagactttcttcccaagagtaggatccatc 2445
Query: 1895 atgaaacacatagcctctctaagagctttgctgctattgaagtagtgatcacaatccaca 1954
|| |||||||| ||||| | ||| || ||||| | || | || || |||||||| | |
Sbjct: 2444 ataaaacacatggcctcacgaagggccctgctgttgtttatataatggtcacaatcaaga 2385
Query: 1955 ttaagaagataagcaccattcgtcaggacagctgatacgcgaatcaaagcattcatggca 2014
|| || | ||||| ||||| || || || || || || |||| ||| | |||||| |||
Sbjct: 2384 ttgagcatataagggccattggtaagaactgcggaaacacgaaccaatgaattcattgca 2325
Query: 2015 ccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacataaacaagccgt 2074
||||| || |||||||| | || || || |||||||||||||||||||| ||||| ||
Sbjct: 2324 ccagcttttttgtggtgttcaaaaccaggtctcttttcacgagaaacatatacaagtcga 2265
Query: 2075 ggcaactcattcccatccgtgtcaagcccaccactgtggcccaagaatacttggatcatt 2134
|| | ||||| ||||| ||||||||||||||||| || || ||||| || || |||||
Sbjct: 2264 ggtagttcattgccatcggtgtcaagcccaccactatgacctaagaacacctgtatcatc 2205
Query: 2135 ccnggatgatctctagggttattcccaggccanggagtgccatcagccatggtccagccc 2194
|| ||||| || | | ||||| |||||||| || || ||||| ||| |||||||
Sbjct: 2204 ccaggatggtcccgggtattatttccaggccaaggtgttccatcttgcataatccagcct 2145
Query: 2195 tcctcaggtattttttgcgcttttgcaacaagggcatcgatccgtactttgaactcttca 2254
|| ||||| | || || ||||| |||||||| |||| ||| || || ||||||||||||
Sbjct: 2144 tcttcaggaaccttctgagctttagcaacaagagcattgattcggaccttgaactcttca 2085
Query: 2255 tactccctcttcatagcccgcctttctttcacaaaagaaggttgtattttgtcctttagg 2314
|| || |||||||| || | | |||||| |||||||||||||| | ||| ||||| ||
Sbjct: 2084 tattctctcttcattgctctacgttcttttacaaaagaaggttgcactttatccttcaga 2025
Query: 2315 taatctatctttcgagcaaagtaaaactctggagccctaggttcaatgttgtgtttcttg 2374
|| ||||||||| ||||||| || ||||||||||||| |||||||| | ||| ||
Sbjct: 2024 tagtctatcttttgagcaaaataccactctggagccctgggttcaatatcaaatttttta 1965
Query: 2375 caaaagggaacccatttccttgcaaactctgcggtttcagatagagcttcaaaagtcaac 2434
||| || ||||||||||||||||| |||| ||||||||| || |||||||| || | |
Sbjct: 1964 acaaatggcacccatttccttgcaaattctgaggtttcagaaagggcttcaaatgttagc 1905
Query: 2435 atagctgaaccgtcatcagaaacataacatgatactttgtcaacagggtaatccacagca 2494
|| || | || || ||||| ||||||||||| ||||| ||||| || || ||||||| |
Sbjct: 1904 attgcagctccatcgtcagacacataacatgaaactttatcaactggatagtccacagaa 1845
Query: 2495 agaatggacaggacagtgttgccagtaattagaggaggttccttaagtggatccactgta 2554
||||| |||| ||||| || | || | |||||||| ||||| | ||||| |||||
Sbjct: 1844 agaattgacaaaacagtatttgccgtcacaagaggaggctccttcataggatcaactgtg 1785
Query: 2555 ctaacaaagacatcgattggagccaactgggatggctcaccctccctatcatatctcaa 2613
|| ||||| | ||| | | ||||||||| |||||||| || || ||||| ||||||||
Sbjct: 1784 ctgacaaaaatatcaacagcagccaactgagatggctctccttctctatcgtatctcaa 1726
Score = 145 bits (73), Expect = 1e-032
Identities = 235/289 (81%)
Strand = Plus / Minus
Query: 1045 ggataaacaatggtgttgatgtatgccagtctctccagaagctttagccttccattgtaa 1104
|||||||| ||||||| || |||||||| ||||||| || ||||||||| | |||
Sbjct: 3275 ggataaacggtggtgtttatatatgccagcctctccaaccatttgagccttccagtataa 3216
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
|||||||| || ||||| || |||||||| |||||||| || || || | |||||| ||
Sbjct: 3215 ccataccaaattggacaatgcctgctaagaagaatttccacagagcccaaagcccatcgc 3156
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaagcaaggccga 1224
| |||||||| ||||||||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 3155 agaacttggttcagacgatcagaaagattaattggagcagatcccttgaatgcagggcga 3096
Query: 1225 agtggcatgcagtagatggatatccaacctcttgcatgcatcttgaaaccagttaaaata 1284
| ||||| ||||| || ||| |||||| | |||||||| || || ||||| ||||||
Sbjct: 3095 ggaggcatacagtatattgatcgccaaccacgagcatgcattttaaagccagtcaaaata 3036
Query: 1285 tcttcagtaacagagccatatatccatccgatctctttcccccattctg 1333
||||| || ||||| ||||||||||| || |||||||| ||||| ||||
Sbjct: 3035 tcttctgtcacagaaccatatatccaaccaatctcttttccccaatctg 2987
Score = 61.9 bits (31), Expect = 1e-007
Identities = 70/83 (84%)
Strand = Plus / Minus
Query: 811 gcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcatttctccaccaatcc 870
||||||||||| ||||| || ||||| ||||| ||||||||||| |||||||| ||
Sbjct: 3509 gcaaagagatgagcagacacacctccaatcacccagaactgctcattcctccaccattca 3450
Query: 871 tcaatgccaacaccactccatcg 893
||||||||||| || ||||||||
Sbjct: 3449 tcaatgccaaccccgctccatcg 3427
>gb|DR384721.1|DR384721 RTHG1_4_D04.b1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_4_D04_A029 3', mRNA sequence
Length = 749
Score = 168 bits (85), Expect = 8e-040
Identities = 355/446 (79%)
Strand = Plus / Plus
Query: 2117 aagaatacttggatcattccnggatgatctctagggttattcccaggccanggagtgcca 2176
|||||||| |||||||| || ||||| |||| || ||| || || ||||| ||||| |||
Sbjct: 7 aagaatacctggatcatccccggatggtctcgagtgttgttgcctggccatggagttcca 66
Query: 2177 tcagccatggtccagccctcctcaggtattttttgcgcttttgcaacaagggcatcgatc 2236
|| ||||||||| ||||| || || | ||| |||||||| || ||||| |||| |||
Sbjct: 67 tcttgcatggtccatccctcttctggcactttntgcgctttggccacaagagcattaatc 126
Query: 2237 cgtactttgaactcttcatactccctcttcatagcccgcctttctttcacaaaagaaggt 2296
|| | ||| |||||||||| ||||||||||| || | || |||||| ||||| |||||
Sbjct: 127 cggatcttgtactcttcatattccctcttcattgctctccgttctttaacaaaggaaggc 186
Query: 2297 tgtattttgtcctttaggtaatctatctttcgagcaaagtaaaactctggagccctaggt 2356
|||| ||| ||||| | ||||| ||||| | |||||||| || ||||||||||| ||
Sbjct: 187 tgtactttatccttcaaataatcaatcttctgggcaaagtagaattctggagccctgggc 246
Query: 2357 tcaatgttgtgtttcttgcaaaagggaacccatttccttgcaaactctgcggtttcagat 2416
|| || ||| ||| |||||||| || ||||| |||||||| || |||| ||||| ||
Sbjct: 247 tcgatactgtattttttgcaaaatggcacccacttccttgcgaattctgaagtttctgaa 306
Query: 2417 agagcttcaaaagtcaacatagctgaaccgtcatcagaaacataacatgatactttgtca 2476
|| | ||||||||||||||| || | || |||||||||||||| ||||| ||||| ||
Sbjct: 307 agggtttcaaaagtcaacattgccgctccatcatcagaaacatagcatgaaactttatcg 366
Query: 2477 acagggtaatccacagcaagaatggacaggacagtgttgccagtaattagaggaggttcc 2536
||||| |||||||| ||||| || ||||| ||||| || | || | |||||||| |||
Sbjct: 367 acaggataatccacggcaaggatagacagaacagtatttgctgtgacaagaggaggctcc 426
Query: 2537 ttaagtggatccactgtactaacaaa 2562
|| || |||||||||||||| |||||
Sbjct: 427 tttagaggatccactgtactgacaaa 452
>gb|BF778499.1|BF778499 NXSI_085_D12_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_085_D12 5' similar to Arabidopsis thaliana
sequence At5g05170 cellulose synthase catalytic subunit
(Ath-B) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 450
Score = 145 bits (73), Expect = 1e-032
Identities = 235/289 (81%)
Strand = Plus / Minus
Query: 1045 ggataaacaatggtgttgatgtatgccagtctctccagaagctttagccttccattgtaa 1104
|||||||| ||||||| || |||||||| ||||||| || ||||||||| | |||
Sbjct: 295 ggataaacggtggtgtttatatatgccagcctctccaaccatttgagccttccagtataa 236
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
|||||||| || ||||| || |||||||| |||||||| || || || | |||||| ||
Sbjct: 235 ccataccaaattggacaatgcctgctaagaagaatttccacagagcccaaagcccatcgc 176
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaagcaaggccga 1224
| |||||||| ||||||||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 175 agaacttggttcagacgatcagaaagattaattggagcagatcccttgaatgcagggcga 116
Query: 1225 agtggcatgcagtagatggatatccaacctcttgcatgcatcttgaaaccagttaaaata 1284
| ||||| ||||| || ||| |||||| | |||||||| || || ||||| ||||||
Sbjct: 115 ggaggcatacagtatattgatcgccaaccacgagcatgcattttaaagccagtcaaaata 56
Query: 1285 tcttcagtaacagagccatatatccatccgatctctttcccccattctg 1333
||||| || ||||| ||||||||||| || |||||||| ||||| ||||
Sbjct: 55 tcttctgtcacagaaccatatatccaaccaatctctttaccccaatctg 7
>gb|BQ196805.1|BQ196805 NXLV105_E07_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV105_E07 5' similar to Arabidopsis thaliana
sequence At4g32410 cellulose synthase catalytic subunit
(RSW1) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 758
Score = 129 bits (65), Expect = 7e-028
Identities = 197/241 (81%)
Strand = Plus / Minus
Query: 1093 cttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaacca 1152
|||||| |||| |||||||| || ||||| || ||||| |||| ||||||||| ||||||
Sbjct: 407 cttccagtgtagccataccaaattggacaatgcctgctcagtaaaatttcaacagaacca 348
Query: 1153 agagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaacccttg 1212
|| ||||| || |||||||| || | |||||| |||||||| ||||| ||||| ||||||
Sbjct: 347 agggcccatcgaaacacttgattcaaacgatctgaaagattgattggtgcagatcccttg 288
Query: 1213 aagcaaggccgaagtggcatgcagtagatggatatccaacctcttgcatgcatcttgaaa 1272
|| ||| || ||||||||||| || || ||||| |||| |||||||| || ||
Sbjct: 287 aatgcaggacgtgcaggcatgcagtatattgaaatccagcctcgagcatgcattttaaac 228
Query: 1273 ccagttaaaatatcttcagtaacagagccatatatccatccgatctctttcccccattct 1332
||||| ||||||||||| || ||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 227 ccagtcaaaatatcttctgtgacagaaccataaatccacccaatctcttttccccattct 168
Query: 1333 g 1333
|
Sbjct: 167 g 167
>gb|CO201610.1|CO201610 RTCNT2_7_A01.b1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_7_A01_A029 3', mRNA sequence
Length = 681
Score = 129 bits (65), Expect = 7e-028
Identities = 197/241 (81%)
Strand = Plus / Plus
Query: 1093 cttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaacca 1152
|||||| |||| |||||||| || ||||| || ||||| |||||||||||||| ||||||
Sbjct: 14 cttccagtgtagccataccaaattggacaatgcctgctcagtagaatttcaacagaacca 73
Query: 1153 agagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaacccttg 1212
|| ||||| || | |||||| || | |||||| |||||||| ||||| ||||| ||||||
Sbjct: 74 agggcccatcggagcacttgattcaaacgatctgaaagattgattggtgcagatcccttg 133
Query: 1213 aagcaaggccgaagtggcatgcagtagatggatatccaacctcttgcatgcatcttgaaa 1272
|| ||| || ||||||||||| || || ||||| |||| |||||||| || ||
Sbjct: 134 aatgcaggacgtgcaggcatgcagtatattgaaatccagcctcgagcatgcattttaaac 193
Query: 1273 ccagttaaaatatcttcagtaacagagccatatatccatccgatctctttcccccattct 1332
||||| ||||||||||| || ||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 194 ccagtcaaaatatcttctgtgacagaaccataaatccacccaatctcttttccccattct 253
Query: 1333 g 1333
|
Sbjct: 254 g 254
Score = 42.1 bits (21), Expect = 0.12
Identities = 63/77 (81%)
Strand = Plus / Plus
Query: 1691 acaggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaaca 1750
||||||||||| ||||| | || || ||||| || || || ||||| ||||||||||||
Sbjct: 605 acaggatcataaccatagagtgcttgtctattaaagcaacaacctgtacccacataaaca 664
Query: 1751 ggtccttgaatgccatc 1767
|| ||||| || |||||
Sbjct: 665 ggcccttggataccatc 681
>gb|CO369942.1|CO369942 RTK1_55_A04.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_55_A04_A029 5', mRNA sequence
Length = 695
Score = 129 bits (65), Expect = 7e-028
Identities = 197/241 (81%)
Strand = Plus / Minus
Query: 1093 cttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaacca 1152
|||||| |||| |||||||| || ||||| || ||||| |||||||||||||| ||||||
Sbjct: 359 cttccagtgtagccataccaaattggacaatgcctgctcagtagaatttcaacagaacca 300
Query: 1153 agagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaacccttg 1212
|| ||||| || | |||||| || | |||||| |||||||| ||||| ||||| ||||||
Sbjct: 299 agggcccatcggagcacttgattcaaacgatctgaaagattgattggtgcagatcccttg 240
Query: 1213 aagcaaggccgaagtggcatgcagtagatggatatccaacctcttgcatgcatcttgaaa 1272
|| ||| || ||||||||||| || || ||||| |||| |||||||| || ||
Sbjct: 239 aatgcaggacgtgcaggcatgcagtatattgaaatccagcctcgagcatgcattttaaac 180
Query: 1273 ccagttaaaatatcttcagtaacagagccatatatccatccgatctctttcccccattct 1332
||||| ||||||||||| || ||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 179 ccagtcaaaatatcttctgtgacagaaccataaatccacccaatctcttttccccattct 120
Query: 1333 g 1333
|
Sbjct: 119 g 119
Score = 61.9 bits (31), Expect = 1e-007
Identities = 97/119 (81%)
Strand = Plus / Minus
Query: 763 aagtttgtgtcgatccctgctagcacttttaagagaccttggaacacagcaaagagatgt 822
||||||||||| ||||||||||| ||||| | | ||||| || || ||||| ||||||
Sbjct: 689 aagtttgtgtcaatccctgctagaactttcagtaacccttgaaagacggcaaacagatgt 630
Query: 823 gcagaggtgccaccaatgacccaaaactgctcatttctccaccaatcctcaatgccaac 881
|| || || ||||| |||||||| |||||||| |||||||| || |||||||||||
Sbjct: 629 gctgatacacctccaataacccaaaattgctcattcctccaccattcatcaatgccaac 571
>dbj|BD236020.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 3851
Score = 119 bits (60), Expect = 7e-025
Identities = 170/207 (82%)
Strand = Plus / Minus
Query: 1936 gtagtgatcacaatccacattaagaagataagcaccattcgtcaggacagctgatacgcg 1995
||||||||||||||||| ||| || | | | | | |||| || || ||||| || || ||
Sbjct: 1880 gtagtgatcacaatccagattcagcataaatggagcattggtgagcacagcagaaacccg 1821
Query: 1996 aatcaaagcattcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacg 2055
|| |||||||||||||||||| ||||||||||| |||||||| || || ||||| |||||
Sbjct: 1820 aaccaaagcattcatggcaccggccttcttgtgatgctggaaaccaggtctcttctcacg 1761
Query: 2056 agaaacataaacaagccgtggcaactcattcccatccgtgtcaagcccaccactgtggcc 2115
||||||||| || ||||| || | |||||| || || || || || || |||||||| ||
Sbjct: 1760 agaaacatatactagccgaggaagctcattgccttctgtatcgaggccgccactgtgacc 1701
Query: 2116 caagaatacttggatcattccnggatg 2142
|||||| ||||||||||| || |||||
Sbjct: 1700 caagaacacttggatcataccaggatg 1674
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 3292 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 3233
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 3232 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 3183
Score = 67.9 bits (34), Expect = 2e-009
Identities = 58/66 (87%)
Strand = Plus / Minus
Query: 1729 gcatcctgttcccacataaacaggtccttgaatgccatctagacccttcatattaatatc 1788
|||||| ||||||||||| ||||| |||||||| ||||| ||||| ||||| || |||||
Sbjct: 2087 gcatccagttcccacatatacaggcccttgaattccatccagacctttcatgttgatatc 2028
Query: 1789 aaagaa 1794
||||||
Sbjct: 2027 aaagaa 2022
Score = 58.0 bits (29), Expect = 2e-006
Identities = 95/117 (81%)
Strand = Plus / Minus
Query: 2368 tttcttgcaaaagggaacccatttccttgcaaactctgcggtttcagatagagcttcaaa 2427
||||||||| || || |||||||| || ||||| |||| ||| ||||| |||| ||||||
Sbjct: 1448 tttcttgcagaatggtacccattttctggcaaattctgaggtctcagagagagattcaaa 1389
Query: 2428 agtcaacatagctgaaccgtcatcagaaacataacatgatactttgtcaacagggta 2484
||| | ||| | | ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 1388 agtaagcatcgacgctccgtcatcagagacataacaggacacattgtctacagggta 1332
Score = 46.1 bits (23), Expect = 0.008
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
||||||||||| ||||| | ||| || || || || || ||||| |||||||| | ||||
Sbjct: 2530 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 2471
Query: 1321 ttcccccattctgttttatcctcatat 1347
|| |||||||| ||||| || ||||||
Sbjct: 2470 tttccccattccgttttgtcttcatat 2444
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 2686 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 2627
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 2626 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 2577
>gb|AY639654.1| Pinus radiata cellulose synthase catalytic subunit (CesA1) mRNA,
complete cds
Length = 3911
Score = 119 bits (60), Expect = 7e-025
Identities = 170/207 (82%)
Strand = Plus / Minus
Query: 1936 gtagtgatcacaatccacattaagaagataagcaccattcgtcaggacagctgatacgcg 1995
||||||||||||||||| ||| || | | | | | |||| || || ||||| || || ||
Sbjct: 1896 gtagtgatcacaatccagattcagcataaatggagcattggtgagcacagcagaaacccg 1837
Query: 1996 aatcaaagcattcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacg 2055
|| |||||||||||||||||| ||||||||||| |||||||| || || ||||| |||||
Sbjct: 1836 aaccaaagcattcatggcaccggccttcttgtgatgctggaaaccaggtctcttctcacg 1777
Query: 2056 agaaacataaacaagccgtggcaactcattcccatccgtgtcaagcccaccactgtggcc 2115
||||||||| || ||||| || | |||||| || || || || || || |||||||| ||
Sbjct: 1776 agaaacatatactagccgaggaagctcattgccttctgtatcgaggccgccactgtgacc 1717
Query: 2116 caagaatacttggatcattccnggatg 2142
|||||| ||||||||||| || |||||
Sbjct: 1716 caagaacacttggatcataccaggatg 1690
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 3308 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 3249
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 3248 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 3199
Score = 67.9 bits (34), Expect = 2e-009
Identities = 58/66 (87%)
Strand = Plus / Minus
Query: 1729 gcatcctgttcccacataaacaggtccttgaatgccatctagacccttcatattaatatc 1788
|||||| ||||||||||| ||||| |||||||| ||||| ||||| ||||| || |||||
Sbjct: 2103 gcatccagttcccacatatacaggcccttgaattccatccagacctttcatgttgatatc 2044
Query: 1789 aaagaa 1794
||||||
Sbjct: 2043 aaagaa 2038
Score = 58.0 bits (29), Expect = 2e-006
Identities = 95/117 (81%)
Strand = Plus / Minus
Query: 2368 tttcttgcaaaagggaacccatttccttgcaaactctgcggtttcagatagagcttcaaa 2427
||||||||| || || |||||||| || ||||| |||| ||| ||||| |||| ||||||
Sbjct: 1464 tttcttgcagaatggtacccattttctggcaaattctgaggtctcagagagagattcaaa 1405
Query: 2428 agtcaacatagctgaaccgtcatcagaaacataacatgatactttgtcaacagggta 2484
||| | ||| | | ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 1404 agtaagcatcgacgctccgtcatcagagacataacaggacacattgtctacagggta 1348
Score = 46.1 bits (23), Expect = 0.008
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
||||||||||| ||||| | ||| || || || || || ||||| |||||||| | ||||
Sbjct: 2546 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 2487
Query: 1321 ttcccccattctgttttatcctcatat 1347
|| |||||||| ||||| || ||||||
Sbjct: 2486 tttccccattccgttttgtcttcatat 2460
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 2702 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 2643
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 2642 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 2593
Score = 40.1 bits (20), Expect = 0.49
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcga 894
||||| ||||| ||||| ||||||| |||||| || ||||||| || |||||||| |
Sbjct: 2972 ccaataacccagaactgttcatttcgccaccattcttcaatgctcactccactccacctc 2913
Query: 895 agctccaaaataccagtggc 914
| |||| ||||||||||||
Sbjct: 2912 atttccagaataccagtggc 2893
>gb|AY789652.1| Pinus taeda cellulose synthase catalytic subunit (CesA3) mRNA,
complete cds
Length = 3959
Score = 119 bits (60), Expect = 7e-025
Identities = 170/207 (82%)
Strand = Plus / Minus
Query: 1936 gtagtgatcacaatccacattaagaagataagcaccattcgtcaggacagctgatacgcg 1995
||||||||||||||||| ||| || | | | | | |||| || || ||||| || || ||
Sbjct: 1886 gtagtgatcacaatccagattcagcataaatggagcattggtgagcacagcagaaacccg 1827
Query: 1996 aatcaaagcattcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacg 2055
|| |||||||||||||||||| ||||||||||| |||||||| || || ||||| |||||
Sbjct: 1826 aaccaaagcattcatggcaccggccttcttgtgatgctggaaaccaggtctcttctcacg 1767
Query: 2056 agaaacataaacaagccgtggcaactcattcccatccgtgtcaagcccaccactgtggcc 2115
||||||||| || ||||| || | |||||| || || || || || || |||||||| ||
Sbjct: 1766 agaaacatatactagccgaggaagctcattgccttctgtatcgaggccgccactgtgacc 1707
Query: 2116 caagaatacttggatcattccnggatg 2142
|||||| ||||||||||| || |||||
Sbjct: 1706 caagaacacttggatcataccaggatg 1680
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 3298 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 3239
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 3238 acaataacccagaatgcaaagaaaagcttacccaagagaggaccccatga 3189
Score = 67.9 bits (34), Expect = 2e-009
Identities = 58/66 (87%)
Strand = Plus / Minus
Query: 1729 gcatcctgttcccacataaacaggtccttgaatgccatctagacccttcatattaatatc 1788
|||||| ||||||||||| ||||| |||||||| ||||| ||||| ||||| || |||||
Sbjct: 2093 gcatccagttcccacatatacaggcccttgaattccatccagacctttcatgttgatatc 2034
Query: 1789 aaagaa 1794
||||||
Sbjct: 2033 aaagaa 2028
Score = 65.9 bits (33), Expect = 9e-009
Identities = 156/197 (79%)
Strand = Plus / Minus
Query: 2368 tttcttgcaaaagggaacccatttccttgcaaactctgcggtttcagatagagcttcaaa 2427
||||||||| || || |||||||| || ||||| |||| ||| ||||| |||| ||||||
Sbjct: 1454 tttcttgcagaatggtacccattttctggcaaattctgaggtctcagagagagattcaaa 1395
Query: 2428 agtcaacatagctgaaccgtcatcagaaacataacatgatactttgtcaacagggtaatc 2487
||| | ||| | | ||||||||||| |||||||| || || ||||| |||||||| ||
Sbjct: 1394 agtaagcatcgacgctccgtcatcagagacataacaggacacattgtctacagggtagtc 1335
Query: 2488 cacagcaagaatggacaggacagtgttgccagtaattagaggaggttccttaagtggatc 2547
|| | ||| || || | || || ||| |||||| | |||||| ||||| ||||||||
Sbjct: 1334 tactgaaaggattgataatactgtattggcagtaaccaaaggaggctccttcagtggatc 1275
Query: 2548 cactgtactaacaaaga 2564
||| ||||| |||||||
Sbjct: 1274 cacagtactcacaaaga 1258
Score = 46.1 bits (23), Expect = 0.008
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
||||||||||| ||||| | ||| || || || || || ||||| |||||||| | ||||
Sbjct: 2536 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 2477
Query: 1321 ttcccccattctgttttatcctcatat 1347
|| |||||||| ||||| || ||||||
Sbjct: 2476 tttccccattccgttttgtcttcatat 2450
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 2692 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 2633
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 2632 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 2583
Score = 40.1 bits (20), Expect = 0.49
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcga 894
||||| ||||| ||||| ||||||| |||||| || ||||||| || |||||||| |
Sbjct: 2962 ccaataacccagaactgttcatttcgccaccattcttcaatgctcactccactccacctc 2903
Query: 895 agctccaaaataccagtggc 914
| |||| ||||||||||||
Sbjct: 2902 atttccagaataccagtggc 2883
>gb|AL750979.1|AL750979 AL750979 RS Pinus pinaster cDNA clone RS02F11 similar to CELLULOSE
SYNTHASE, mRNA sequence
Length = 420
Score = 107 bits (54), Expect = 3e-021
Identities = 177/218 (81%)
Strand = Plus / Minus
Query: 1093 cttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaacca 1152
|||||| |||| |||||||| || ||||| || ||||| |||| ||||||||| || |||
Sbjct: 222 cttccagtgtagccataccaaattggacaatgcctgctcagtaaaatttcaacagagcca 163
Query: 1153 agagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaacccttg 1212
|| ||||| || | |||||| || | |||||| |||||||| ||||| ||||||||||||
Sbjct: 162 agggcccatcggagcacttgattcaaacgatctgaaagattgattggtgcagaacccttg 103
Query: 1213 aagcaaggccgaagtggcatgcagtagatggatatccaacctcttgcatgcatcttgaaa 1272
|| ||| || ||||||||||| || || ||||| |||| |||||||| || ||
Sbjct: 102 aatgcaggacgtgcaggcatgcagtatattgaaatccagcctcgagcatgcattttaaac 43
Query: 1273 ccagttaaaatatcttcagtaacagagccatatatcca 1310
||||| ||||||||||| || ||||||||||| |||||
Sbjct: 42 ccagtcaaaatatcttctgtgacagagccataaatcca 5
>gb|DR017425.1|DR017425 STRS1_16_E10.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_16_E10_A034 3', mRNA sequence
Length = 852
Score = 107 bits (54), Expect = 3e-021
Identities = 159/194 (81%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | |||||||| || ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 303 agaagactggtccacttaaaaacataaagctcagcaaattcaccatcttcatctgaagac 244
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgctagcacttttaagagaccttggaac 807
||||||||||| || ||||||||||| ||||||||||| ||||| | | ||||| ||
Sbjct: 243 tttgatgtgacagtaaagtttgtgtcaatccctgctagaactttcagtaacccttgaaag 184
Query: 808 acagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcatttctccaccaa 867
|| ||||| |||||||| || || ||||| |||||||| |||||||| ||||||||
Sbjct: 183 acggcaaacagatgtgctgatacacctccaataacccaaaattgctcattcctccaccat 124
Query: 868 tcctcaatgccaac 881
|| |||||||||||
Sbjct: 123 tcatcaatgccaac 110
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 545 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 486
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 485 gtgtccggttctg 473
>gb|DR017506.1|DR017506 STRS1_16_E10.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_16_E10_A034 5', mRNA sequence
Length = 730
Score = 107 bits (54), Expect = 3e-021
Identities = 159/194 (81%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | |||||||| || ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 564 agaagactggtccacttaaaaacataaagctcagcaaattcaccatcttcatctgaagac 505
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgctagcacttttaagagaccttggaac 807
||||||||||| || ||||||||||| ||||||||||| ||||| | | ||||| ||
Sbjct: 504 tttgatgtgacagtaaagtttgtgtcaatccctgctagaactttcagtaacccttgaaag 445
Query: 808 acagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcatttctccaccaa 867
|| ||||| |||||||| || || ||||| |||||||| |||||||| ||||||||
Sbjct: 444 acggcaaacagatgtgctgatacacctccaataacccaaaattgctcattcctccaccat 385
Query: 868 tcctcaatgccaac 881
|| |||||||||||
Sbjct: 384 tcatcaatgccaac 371
Score = 91.7 bits (46), Expect = 2e-016
Identities = 103/122 (84%)
Strand = Plus / Minus
Query: 1093 cttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaacca 1152
|||||| |||| |||||||| || ||||| || ||||| |||||||||||||| ||||||
Sbjct: 159 cttccagtgtagccataccaaattggacaatgcctgctcagtagaatttcaacagaacca 100
Query: 1153 agagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaacccttg 1212
|| ||||| || | |||||| || | |||||| |||||||| ||||| ||||| ||||||
Sbjct: 99 agggcccatcggagcacttgattcaaacgatctgaaagattgattggtgcagatcccttg 40
Query: 1213 aa 1214
||
Sbjct: 39 aa 38
>gb|DR744890.1|DR744890 RTCU1_25_C12.g1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_25_C12_A029 5', mRNA sequence
Length = 754
Score = 107 bits (54), Expect = 3e-021
Identities = 144/174 (82%)
Strand = Plus / Minus
Query: 1693 aggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacagg 1752
||||||||| ||||||| || ||||| |||||| |||||| || |||||||| || ||
Sbjct: 212 aggatcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactgg 153
Query: 1753 tccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgc 1812
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | ||||||
Sbjct: 152 cccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgc 93
Query: 1813 atatcgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagca 1866
|||||||||||| || |||||||| ||||| || || ||||||||||||||
Sbjct: 92 atatcgatcatggcgatcaataccatcgaatctctgagggaactgaacatagca 39
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 616 ccatatatccatccgatctcctttccccattcagttttctcctc 573
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 487 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 429
Score = 38.2 bits (19), Expect = 1.9
Identities = 40/47 (85%)
Strand = Plus / Minus
Query: 1523 taaccttcaaatccctcttctatatcttccatgttgaagatgggagc 1569
|||||||||| ||| ||||| || ||||| | | |||||||||||||
Sbjct: 403 taaccttcaagtccttcttcaatctcttcgaggctgaagatgggagc 357
>gb|AY262816.1| Pinus radiata cellulose synthase (CesA5) mRNA, partial cds
Length = 1989
Score = 107 bits (54), Expect = 3e-021
Identities = 144/174 (82%)
Strand = Plus / Minus
Query: 1693 aggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacagg 1752
||||||||| ||||||| || ||||| |||||| |||||| || |||||||| || ||
Sbjct: 202 aggatcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactgg 143
Query: 1753 tccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgc 1812
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | ||||||
Sbjct: 142 cccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgc 83
Query: 1813 atatcgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagca 1866
|||||||||||| || |||||||| ||||| || || ||||||||||||||
Sbjct: 82 atatcgatcatggcgatcaataccatcgaatctctgagggaactgaacatagca 29
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 606 ccatatatccatccgatctcctttccccattcagttttctcctc 563
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 477 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 419
Score = 44.1 bits (22), Expect = 0.032
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggagc 1569
||||||||||||| ||| ||||| || ||||| | | |||||||||||||
Sbjct: 396 tcgtaaccttcaagtccttcttcaatctcttcgaggctgaagatgggagc 347
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 1107 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 1048
Query: 859 ctcca 863
|||||
Sbjct: 1047 ctcca 1043
>gb|AY262817.1| Pinus radiata cellulose synthase (CesA6) mRNA, partial cds
Length = 2489
Score = 107 bits (54), Expect = 3e-021
Identities = 144/174 (82%)
Strand = Plus / Minus
Query: 1693 aggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacagg 1752
||||||||| ||||||| || ||||| |||||| |||||| || |||||||| || ||
Sbjct: 760 aggatcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactgg 701
Query: 1753 tccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgc 1812
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | ||||||
Sbjct: 700 cccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgc 641
Query: 1813 atatcgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagca 1866
|||||||||||| || |||||||| ||||| || || ||||||||||||||
Sbjct: 640 atatcgatcatggcgatcaataccatcgaatctctgagggaactgaacatagca 587
Score = 65.9 bits (33), Expect = 9e-009
Identities = 57/65 (87%)
Strand = Plus / Minus
Query: 2006 ttcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacataa 2065
||||||||||| || |||||||||||||| | || || ||||||||||||||||||||
Sbjct: 447 ttcatggcaccggctttcttgtggtgctgatatccaggtctcttttcacgagaaacatag 388
Query: 2066 acaag 2070
|||||
Sbjct: 387 acaag 383
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 1164 ccatatatccatccgatctcctttccccattcagttttctcctc 1121
Score = 50.1 bits (25), Expect = 5e-004
Identities = 136/173 (78%)
Strand = Plus / Minus
Query: 2240 actttgaactcttcatactccctcttcatagcccgcctttctttcacaaaagaaggttgt 2299
|||||||||||||||||||| | ||||| || |||| ||||| ||||| | |||||
Sbjct: 213 actttgaactcttcatactctcgtttcatggcacgccgctcttttacaaaggtcggttgc 154
Query: 2300 attttgtcctttaggtaatctatctttcgagcaaagtaaaactctggagccctaggttca 2359
| ||||| || |||||||| || || ||| ||||||||| || || |||| ||| ||
Sbjct: 153 accttgtctttcaggtaatcaattttctgagaaaagtaaaaatcgggggcccgaggctct 94
Query: 2360 atgttgtgtttcttgcaaaagggaacccatttccttgcaaactctgcggtttc 2412
|| ||| || ||||| || ||||||||||||| |||||||||| ||||||
Sbjct: 93 atactgtactttttgcagaaaggaacccatttccgggcaaactctgaggtttc 41
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 1035 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 977
Score = 44.1 bits (22), Expect = 0.032
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggagc 1569
||||||||||||| ||| ||||| || ||||| | | |||||||||||||
Sbjct: 954 tcgtaaccttcaagtccttcttcaatctcttcgaggctgaagatgggagc 905
>gb|AY262819.1| Pinus radiata cellulose synthase (CesA8) mRNA, partial cds
Length = 2287
Score = 107 bits (54), Expect = 3e-021
Identities = 144/174 (82%)
Strand = Plus / Minus
Query: 1693 aggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacagg 1752
||||||||| ||||||| || ||||| |||||| |||||| || |||||||| || ||
Sbjct: 609 aggatcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactgg 550
Query: 1753 tccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgc 1812
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | ||||||
Sbjct: 549 cccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgc 490
Query: 1813 atatcgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagca 1866
|||||||||||| || |||||||| ||||| || || ||||||||||||||
Sbjct: 489 atatcgatcatggcgatcaataccatcgaatctctgagggaactgaacatagca 436
Score = 65.9 bits (33), Expect = 9e-009
Identities = 57/65 (87%)
Strand = Plus / Minus
Query: 2006 ttcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacataa 2065
||||||||||| || |||||||||||||| | || || ||||||||||||||||||||
Sbjct: 296 ttcatggcaccggctttcttgtggtgctgatatccaggtctcttttcacgagaaacatag 237
Query: 2066 acaag 2070
|||||
Sbjct: 236 acaag 232
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 884 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 826
Score = 44.1 bits (22), Expect = 0.032
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggagc 1569
||||||||||||| ||| ||||| || ||||| | | |||||||||||||
Sbjct: 803 tcgtaaccttcaagtccttcttcaatctcttcgaggctgaagatgggagc 754
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 1553 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 1494
Query: 859 ctcca 863
|||||
Sbjct: 1493 ctcca 1489
Score = 40.1 bits (20), Expect = 0.49
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 2240 actttgaactcttcatactc 2259
||||||||||||||||||||
Sbjct: 62 actttgaactcttcatactc 43
Score = 38.2 bits (19), Expect = 1.9
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatct 1318
|||||||||||||||||||
Sbjct: 1052 ccatatatccatccgatct 1034
>gb|DR020730.1|DR020730 STRS1_38_H10.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_38_H10_A034 5', mRNA sequence
Length = 557
Score = 105 bits (53), Expect = 1e-020
Identities = 188/233 (80%)
Strand = Plus / Minus
Query: 1093 cttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaacca 1152
|||||| |||| |||||||| || ||||| || ||||| |||| ||||||||| ||||||
Sbjct: 233 cttccagtgtagccataccaaattggacaatgcctgctcagtaaaatttcaacagaacca 174
Query: 1153 agagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaacccttg 1212
|| ||||| || | |||||| || | |||||| |||||||| ||||| ||||| ||||||
Sbjct: 173 agggcccatcgaagcacttgattcaaacgatctgaaagattgattggtgcagatcccttg 114
Query: 1213 aagcaaggccgaagtggcatgcagtagatggatatccaacctcttgcatgcatcttgaaa 1272
|| ||| || ||||||||||| || || ||||| |||| |||||||| || ||
Sbjct: 113 aatgcaggacgtgcaggcatgcagtatattgaaatccagcctcgagcatgcattttaaac 54
Query: 1273 ccagttaaaatatcttcagtaacagagccatatatccatccgatctctttccc 1325
||||| |||||||||| || ||||| ||||| ||||| || |||||||||||
Sbjct: 53 ccagtcaaaatatcttatgtgacagaaccataaatccacccaatctctttccc 1
Score = 58.0 bits (29), Expect = 2e-006
Identities = 92/113 (81%)
Strand = Plus / Minus
Query: 769 gtgtcgatccctgctagcacttttaagagaccttggaacacagcaaagagatgtgcagag 828
||||| ||||||||||| ||||| | | ||||| || |||||||| |||||||| ||
Sbjct: 557 gtgtcaatccctgctagaactttcagtaacccttgaaagacagcaaacagatgtgctgat 498
Query: 829 gtgccaccaatgacccaaaactgctcatttctccaccaatcctcaatgccaac 881
|| ||||| |||||||| |||||||| |||||||| || |||||||||||
Sbjct: 497 acacctccaataacccaaaattgctcattcctccaccattcatcaatgccaac 445
>gb|AY789651.1| Pinus taeda cellulose synthase catalytic subunit (CesA2) mRNA,
complete cds
Length = 3478
Score = 105 bits (53), Expect = 1e-020
Identities = 143/173 (82%)
Strand = Plus / Minus
Query: 1694 ggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacaggt 1753
|||||||| ||||||| || ||||| |||||| |||||| || |||||||| || ||
Sbjct: 1907 ggatcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactggc 1848
Query: 1754 ccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgca 1813
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | |||||||
Sbjct: 1847 ccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgca 1788
Query: 1814 tatcgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagca 1866
||||||||||| || |||||||| ||||| || || ||||||||||||||
Sbjct: 1787 tatcgatcatggcgatcaataccatcgaatctctgagggaactgaacatagca 1735
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 2006 ttcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacataa 2065
||||||||||| || |||||||||||||| | || || ||||| ||||||||||||||
Sbjct: 1595 ttcatggcaccggctttcttgtggtgctgatatccaggtctcttctcacgagaaacatag 1536
Query: 2066 acaag 2070
|||||
Sbjct: 1535 acaag 1531
Score = 58.0 bits (29), Expect = 2e-006
Identities = 137/173 (79%)
Strand = Plus / Minus
Query: 2240 actttgaactcttcatactccctcttcatagcccgcctttctttcacaaaagaaggttgt 2299
|||||||||||||||||||| | ||||| || |||| ||||| ||||| | |||||
Sbjct: 1361 actttgaactcttcatactctcgtttcatggcacgccgctcttttacaaaggtcggttgc 1302
Query: 2300 attttgtcctttaggtaatctatctttcgagcaaagtaaaactctggagccctaggttca 2359
| ||||| || |||||||| || ||| ||| ||||||||| || || |||| ||| ||
Sbjct: 1301 accttgtctttcaggtaatcaattttttgagaaaagtaaaaatcgggggcccgaggctct 1242
Query: 2360 atgttgtgtttcttgcaaaagggaacccatttccttgcaaactctgcggtttc 2412
|| ||| || ||||| || ||||||||||||| |||||||||| ||||||
Sbjct: 1241 atactgtactttttgcagaaaggaacccatttccgggcaaactctgaggtttc 1189
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 2312 ccatatatccatccgatctcctttccccattcagttttctcctc 2269
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 2519 gtaattagaggaggttccttaagtggatccactgtactaacaaaga 2564
||||| |||||||| || || ||||||||||||||||| |||||||
Sbjct: 1082 gtaatcagaggaggctctttcagtggatccactgtactcacaaaga 1037
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 2183 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 2125
Score = 44.1 bits (22), Expect = 0.032
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggagc 1569
||||||||||||| ||| ||||| || ||||| | | |||||||||||||
Sbjct: 2102 tcgtaaccttcaagtccttcttcaatctcttcaaggctgaagatgggagc 2053
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 2813 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 2754
Query: 859 ctcca 863
|||||
Sbjct: 2753 ctcca 2749
>gb|AY262818.1| Pinus radiata cellulose synthase (CesA7) mRNA, partial cds
Length = 2588
Score = 105 bits (53), Expect = 1e-020
Identities = 143/173 (82%)
Strand = Plus / Minus
Query: 1694 ggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacaggt 1753
|||||||| ||||||| || ||||| |||||| |||||| || |||||||| || ||
Sbjct: 980 ggatcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactggc 921
Query: 1754 ccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgca 1813
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | |||||||
Sbjct: 920 ccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgca 861
Query: 1814 tatcgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagca 1866
||||||||||| || |||||||| ||||| || || ||||||||||||||
Sbjct: 860 tatcgatcatggcgatcaataccatcgaatctctgagggaactgaacatagca 808
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 2006 ttcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacataa 2065
||||||||||| || |||||||||||||| | || || ||||| ||||||||||||||
Sbjct: 668 ttcatggcaccggctttcttgtggtgctgatatccaggtctcttctcacgagaaacatag 609
Query: 2066 acaag 2070
|||||
Sbjct: 608 acaag 604
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 1385 ccatatatccatccgatctcctttccccattcagttttctcctc 1342
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 2519 gtaattagaggaggttccttaagtggatccactgtactaacaaaga 2564
||||| |||||||| || || ||||||||||||||||| |||||||
Sbjct: 155 gtaatcagaggaggctctttcagtggatccactgtactcacaaaga 110
Score = 50.1 bits (25), Expect = 5e-004
Identities = 136/173 (78%)
Strand = Plus / Minus
Query: 2240 actttgaactcttcatactccctcttcatagcccgcctttctttcacaaaagaaggttgt 2299
|||||||||||||||||||| | ||||| || |||| ||||| ||||| | |||||
Sbjct: 434 actttgaactcttcatactctcgtttcatggcacgccgctcttttacaaaggtcggttgc 375
Query: 2300 attttgtcctttaggtaatctatctttcgagcaaagtaaaactctggagccctaggttca 2359
| ||||| || |||||||| || || ||| ||||||||| || || |||| ||| ||
Sbjct: 374 accttgtctttcaggtaatcaattttctgagaaaagtaaaaatcgggggcccgaggctct 315
Query: 2360 atgttgtgtttcttgcaaaagggaacccatttccttgcaaactctgcggtttc 2412
|| ||| || ||||| || ||||||||||||| |||||||||| ||||||
Sbjct: 314 atactgtactttttgcagaaaggaacccatttccgggcaaactctgaggtttc 262
Score = 44.1 bits (22), Expect = 0.032
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggagc 1569
||||||||||||| ||| ||||| || ||||| | | |||||||||||||
Sbjct: 1175 tcgtaaccttcaagtccttcttcaatctcttcgaggctgaagatgggagc 1126
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 1886 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 1827
Query: 859 ctcca 863
|||||
Sbjct: 1826 ctcca 1822
Score = 38.2 bits (19), Expect = 1.9
Identities = 49/59 (83%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | ||||||||||| || | ||| || ||||||||||| |||||
Sbjct: 1256 gtggatgtaataaagacaggagactggccgaatcttttttcaaagctcttctgcgacat 1198
>gb|BX784298.1|BX784298 BX784298 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 132B11 similar to Cellulose synthase, mRNA
sequence
Length = 540
Score = 103 bits (52), Expect = 4e-020
Identities = 73/80 (91%)
Strand = Plus / Minus
Query: 832 ccaccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccat 891
|||||||| ||||||||||||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 107 ccaccaatcacccaaaactgctcatttctccaccaatcatcaataccaaccccactccat 48
Query: 892 cgaagctccaaaataccagt 911
|| | |||||||| ||||||
Sbjct: 47 cgcatctccaaaacaccagt 28
Score = 61.9 bits (31), Expect = 1e-007
Identities = 110/137 (80%)
Strand = Plus / Minus
Query: 469 gaagcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccatg 528
||||||||||| || | | | ||||| || || || |||||||| ||||||||||||||
Sbjct: 467 gaagcaagaagaacagccnacacaattacaatngtaggtgtgcgattctgcttccccatc 408
Query: 529 agacccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccg 588
| ||| ||||||||||| || | || | |||||||||| ||||||||||| |||||
Sbjct: 407 aaacctttcaggaaaggatataaatgtacaatcacccagaatgcaaagaacattttccca 348
Query: 589 aatagtggaccccatga 605
|| | |||||||||||
Sbjct: 347 aacaaaggaccccatga 331
>gb|CF478017.1|CF478017 RTWW3_17_B06.g1_A022 Well-watered loblolly pine roots WW3 Pinus taeda
cDNA clone RTWW3_17_B06_A022 5', mRNA sequence
Length = 579
Score = 99.6 bits (50), Expect = 6e-019
Identities = 230/290 (79%)
Strand = Plus / Minus
Query: 1030 gggatagatgtaattggataaacaatggtgttgatgtatgccagtctctccagaagcttt 1089
|||||||| || || |||||||| | ||||| |||||||| || |||||||| ||
Sbjct: 290 gggatagaagtgatgggataaactgtagtgtttatgtatgctagcctctccagccatttc 231
Query: 1090 agccttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaa 1149
||||||||| ||||||||||| || ||||| || | ||| || ||||||||||| |||
Sbjct: 230 agccttccaccataaccataccaaattggacaatgacggctgagaagaatttcaacagaa 171
Query: 1150 ccaagagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaaccc 1209
|| | ||||| || | |||||||| | ||||||||||||||| || |||||||| ||
Sbjct: 170 cccaatgcccatcgaagtacttggttcaaacgatcagaaagatttataggagcagaccct 111
Query: 1210 ttgaagcaaggccgaagtggcatgcagtagatggatatccaacctcttgcatgcatcttg 1269
||||| ||| ||| | ||||||||||| |||||| |||| || | |||||||| ||
Sbjct: 110 ttgaatgcagggcgaggaggcatgcagtaaatggatctccagccacgagcatgcatttta 51
Query: 1270 aaaccagttaaaatatcttcagtaacagagccatatatccatccgatctc 1319
|| ||||||||||||||||| || | ||| ||||| ||||| || |||||
Sbjct: 50 aatccagttaaaatatcttccgtcaaagaaccataaatccaaccaatctc 1
Score = 54.0 bits (27), Expect = 3e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcg 893
||||||||||| || || ||||| |||||||| || ||||| ||||| |||||||||||
Sbjct: 485 ccaatgacccagaattgttcattcctccaccattcatcaataccaaccccactccatcg 427
>gb|DR080401.1|DR080401 RTFEPL1_22_A02.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_22_A02_A029 5', mRNA sequence
Length = 741
Score = 99.6 bits (50), Expect = 6e-019
Identities = 143/174 (82%)
Strand = Plus / Minus
Query: 1693 aggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacagg 1752
||||||||| ||||||| || ||||| |||||| ||| || || |||||||| || ||
Sbjct: 698 aggatcatacccatacagagcttgcctgttgaaaacgcacccagtccccacatacactgg 639
Query: 1753 tccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgc 1812
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | ||||||
Sbjct: 638 cccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgc 579
Query: 1813 atatcgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagca 1866
|||||||||||| || |||||||| ||||| || || ||||||||||||||
Sbjct: 578 atatcgatcatggcgatcaataccatcgaatctctgagggaactgaacatagca 525
Score = 65.9 bits (33), Expect = 9e-009
Identities = 57/65 (87%)
Strand = Plus / Minus
Query: 2006 ttcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacataa 2065
||||||||||| || |||||||||||||| | || |||||||| ||||||||||||||
Sbjct: 385 ttcatggcaccggctttcttgtggtgctgatatccaggcctcttctcacgagaaacatag 326
Query: 2066 acaag 2070
|||||
Sbjct: 325 acaag 321
>gb|DR689610.1|DR689610 EST1079696 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWACK80 3' end, mRNA sequence
Length = 707
Score = 99.6 bits (50), Expect = 6e-019
Identities = 158/194 (81%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | |||||||| || ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 227 agaagactggtccacttaaaaacataaagctcagcaaattcaccatcttcatctgaagac 168
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgctagcacttttaagagaccttggaac 807
|||| |||||| || ||||||||||| ||||||||||| ||||| | | ||||| ||
Sbjct: 167 tttggtgtgacagtaaagtttgtgtcaatccctgctagaactttcagtaacccttgaaag 108
Query: 808 acagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcatttctccaccaa 867
|| ||||| |||||||| || || ||||| |||||||| |||||||| ||||||||
Sbjct: 107 acggcaaacagatgtgctgatacacctccaataacccaaaattgctcattcctccaccat 48
Query: 868 tcctcaatgccaac 881
|| |||||||||||
Sbjct: 47 tcatcaatgccaac 34
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 469 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 410
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 409 gtgtccggttctg 397
>gb|DT635390.1|DT635390 EST1150321 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMGG33 3' end, mRNA sequence
Length = 761
Score = 99.6 bits (50), Expect = 6e-019
Identities = 158/194 (81%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | |||||||| || ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 227 agaagactggtccacttaaaaacataaagctcagcaaattcaccatcttcatctgaagac 168
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgctagcacttttaagagaccttggaac 807
|||| |||||| || ||||||||||| ||||||||||| ||||| | | ||||| ||
Sbjct: 167 tttggtgtgacagtaaagtttgtgtcaatccctgctagaactttcagtaacccttgaaag 108
Query: 808 acagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcatttctccaccaa 867
|| ||||| |||||||| || || ||||| |||||||| |||||||| ||||||||
Sbjct: 107 acggcaaacagatgtgctgatacacctccaataacccaaaattgctcattcctccaccat 48
Query: 868 tcctcaatgccaac 881
|| |||||||||||
Sbjct: 47 tcatcaatgccaac 34
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 469 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 410
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 409 gtgtccggttctg 397
>dbj|BD235986.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 383
Score = 99.6 bits (50), Expect = 6e-019
Identities = 140/170 (82%)
Strand = Plus / Minus
Query: 1697 tcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacaggtcct 1756
||||| ||||||| || ||||| |||||| |||||| || |||||||| || || ||
Sbjct: 383 tcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactggcccc 324
Query: 1757 tgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgcatat 1816
|| |||||||||||||||||||| || ||||| ||||| ||| |||| | ||||||||||
Sbjct: 323 tggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgcatat 264
Query: 1817 cgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagca 1866
|||||||| || |||||||| ||||| || || ||||||||||||||
Sbjct: 263 cgatcatggcgatcaataccatcgaatctctgagggaactgaacatagca 214
Score = 65.9 bits (33), Expect = 9e-009
Identities = 57/65 (87%)
Strand = Plus / Minus
Query: 2006 ttcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacataa 2065
||||||||||| || |||||||||||||| | || || ||||||||||||||||||||
Sbjct: 74 ttcatggcaccggctttcttgtggtgctgatatccaggtctcttttcacgagaaacatag 15
Query: 2066 acaag 2070
|||||
Sbjct: 14 acaag 10
>gb|BX249248.1|BX249248 BX249248 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP021G11 similar to Cellulose synthase
catalytic subunit, mRNA sequence
Length = 708
Score = 95.6 bits (48), Expect = 1e-017
Identities = 111/132 (84%)
Strand = Plus / Minus
Query: 1693 aggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacagg 1752
||||||||| ||||||| || ||||| |||||| |||||| || |||||||| || ||
Sbjct: 168 aggatcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactgg 109
Query: 1753 tccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgc 1812
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | ||||||
Sbjct: 108 cccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgc 49
Query: 1813 atatcgatcatg 1824
||||||||||||
Sbjct: 48 atatcgatcatg 37
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 573 ccatatatccatccgatctcctttccccattcagttttctcctc 530
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 443 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 385
Score = 44.1 bits (22), Expect = 0.032
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggagc 1569
||||||||||||| ||| ||||| || ||||| | | |||||||||||||
Sbjct: 362 tcgtaaccttcaagtccttcttcaatctcttcgaggctgaagatgggagc 313
>gb|AW985306.1|AW985306 NXNV_135_F04_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_135_F04 5' similar to Arabidopsis thaliana sequence
At5g44030 cellulose synthase catalytic subunit-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 418
Score = 95.6 bits (48), Expect = 1e-017
Identities = 111/132 (84%)
Strand = Plus / Minus
Query: 1693 aggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacagg 1752
||||||||| ||||||| || ||||| |||||| |||||| || |||||||| || ||
Sbjct: 172 aggatcatacccatacagagcttgcctgttgaaaacgcatccagtccccacatacactgg 113
Query: 1753 tccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgc 1812
|| || |||||||||||||||||||| || ||||| ||||| ||| |||| | ||||||
Sbjct: 112 cccctggatgccatctagacccttcatgttgatatcgaagaaaacagtgtttctgtttgc 53
Query: 1813 atatcgatcatg 1824
||||||||||||
Sbjct: 52 atatcgatcatg 41
>gb|BF186257.1|BF186257 NXCI_135_B10_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_135_B10 5' similar to Arabidopsis
thaliana sequence At5g05170 cellulose synthase catalytic
subunit (Ath-B) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 371
Score = 95.6 bits (48), Expect = 1e-017
Identities = 90/104 (86%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | ||||||||||| ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 104 agaagactggtccacttgaaaacataaagctcagcaaattcaccatcttcatctgaagac 45
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgctagcacttt 791
||||||||||| || ||||||||||| ||||||||||| |||||
Sbjct: 44 tttgatgtgacagtaaagtttgtgtcaatccctgctagaacttt 1
>gb|CD019985.1|CD019985 NXNV008B03 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV008B03 5' similar to Arabidopsis thaliana sequence
At5g05170 cellulose synthase catalytic subunit (Ath-B)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 171
Score = 91.7 bits (46), Expect = 2e-016
Identities = 138/169 (81%)
Strand = Plus / Minus
Query: 698 tccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcctttgatgtga 757
||||||| || ||||| ||||||||||| |||||||| |||| | | |||||||||||
Sbjct: 171 tccacttaaaaacataaagctcagcaaattcaccatcttcatntgaagactttgatgtga 112
Query: 758 ccgtgaagtttgtgtcgatccctgctagcacttttaagagaccttggaacacagcaaaga 817
| || ||||||||||| ||||||||||| ||||| | | ||||| || |||||||| |
Sbjct: 111 cagtaaagtttgtgtcaatccctgctagaactttcagtaacccttgaaagacagcaaaca 52
Query: 818 gatgtgcagaggtgccaccaatgacccaaaactgctcatttctccacca 866
||||||| || || ||||| |||||||| |||||||| ||||||||
Sbjct: 51 gatgtgctgatacacctccaataacccaaaattgctcattcctccacca 3
>gb|CX647876.1|CX647876 COLD1_25_C03.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_25_C03_A029 3', mRNA sequence
Length = 847
Score = 87.7 bits (44), Expect = 2e-015
Identities = 89/104 (85%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | |||||||| || ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 106 agaagactggtccacttaaaaacataaagctcagcaaattcaccatcttcatctgaagac 47
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgctagcacttt 791
||||||||||| || ||||||||||| ||||||||||| |||||
Sbjct: 46 tttgatgtgacagtaaagtttgtgtcaatccctgctagaacttt 3
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 348 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 289
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 288 gtgtccggttctg 276
>gb|AW697996.1|AW697996 NXNV_079_C07_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_079_C07 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 352
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 130 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 71
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 70 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 21
>gb|BG039685.1|BG039685 NXSI_102_H08_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_102_H08 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 546
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 234 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 175
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 174 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 125
>gb|BQ695648.1|BQ695648 NXPV_030_H04_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_030_H04 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 491
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 183 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 124
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 123 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 74
>gb|BQ697774.1|BQ697774 NXPV_052_F10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_052_F10 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 523
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 183 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 124
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 123 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 74
>gb|BQ703105.1|BQ703105 NXSI_136_D09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_136_D09 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 483
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 216 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 157
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 156 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 107
>gb|DR060720.1|DR060720 RTNIT1_29_C08.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_29_C08_A029 5', mRNA sequence
Length = 789
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Plus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 625 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 684
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 685 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 734
>gb|AH014290.1|SEG_AY764673S Pinus taeda isolate 11 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764674.1|AY764673S2 Pinus taeda isolate 11 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014291.1|SEG_AY764675S Pinus taeda isolate 16 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764676.1|AY764675S2 Pinus taeda isolate 16 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014292.1|SEG_AY764677S Pinus taeda isolate 25 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764678.1|AY764677S2 Pinus taeda isolate 25 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014293.1|SEG_AY764679S Pinus taeda isolate 7 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764680.1|AY764679S2 Pinus taeda isolate 7 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014294.1|SEG_AY764681S Pinus taeda isolate 6 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764682.1|AY764681S2 Pinus taeda isolate 6 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014295.1|SEG_AY764683S Pinus taeda isolate 4 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764684.1|AY764683S2 Pinus taeda isolate 4 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014296.1|SEG_AY764685S Pinus taeda isolate 26 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764686.1|AY764685S2 Pinus taeda isolate 26 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014297.1|SEG_AY764687S Pinus taeda isolate 9 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764688.1|AY764687S2 Pinus taeda isolate 9 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014298.1|SEG_AY764689S Pinus taeda isolate 23 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764690.1|AY764689S2 Pinus taeda isolate 23 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014299.1|SEG_AY764691S Pinus taeda isolate 13 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764692.1|AY764691S2 Pinus taeda isolate 13 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014300.1|SEG_AY764693S Pinus taeda isolate 30 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764694.1|AY764693S2 Pinus taeda isolate 30 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014301.1|SEG_AY764695S Pinus taeda isolate 22 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764696.1|AY764695S2 Pinus taeda isolate 22 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014302.1|SEG_AY764697S Pinus taeda isolate 32 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764698.1|AY764697S2 Pinus taeda isolate 32 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014303.1|SEG_AY764699S Pinus taeda isolate 18 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764700.1|AY764699S2 Pinus taeda isolate 18 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014304.1|SEG_AY764701S Pinus taeda isolate 10 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764702.1|AY764701S2 Pinus taeda isolate 10 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014305.1|SEG_AY764703S Pinus taeda isolate 14 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764704.1|AY764703S2 Pinus taeda isolate 14 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014306.1|SEG_AY764705S Pinus taeda isolate 21 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764706.1|AY764705S2 Pinus taeda isolate 21 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014307.1|SEG_AY764707S Pinus taeda isolate 31 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764708.1|AY764707S2 Pinus taeda isolate 31 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014308.1|SEG_AY764709S Pinus taeda isolate 5 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764710.1|AY764709S2 Pinus taeda isolate 5 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014309.1|SEG_AY764711S Pinus taeda isolate 2 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764712.1|AY764711S2 Pinus taeda isolate 2 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014310.1|SEG_AY764713S Pinus taeda isolate 3 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764714.1|AY764713S2 Pinus taeda isolate 3 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014311.1|SEG_AY764715S Pinus taeda isolate 19 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764716.1|AY764715S2 Pinus taeda isolate 19 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014312.1|SEG_AY764717S Pinus taeda isolate 28 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764718.1|AY764717S2 Pinus taeda isolate 28 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014313.1|SEG_AY764719S Pinus taeda isolate 17 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764720.1|AY764719S2 Pinus taeda isolate 17 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014314.1|SEG_AY764721S Pinus taeda isolate 8 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764722.1|AY764721S2 Pinus taeda isolate 8 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014315.1|SEG_AY764723S Pinus taeda isolate 15 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764724.1|AY764723S2 Pinus taeda isolate 15 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014316.1|SEG_AY764725S Pinus taeda isolate 1 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764726.1|AY764725S2 Pinus taeda isolate 1 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014317.1|SEG_AY764727S Pinus taeda isolate 29 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764728.1|AY764727S2 Pinus taeda isolate 29 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014318.1|SEG_AY764729S Pinus taeda isolate 20 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaataacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764730.1|AY764729S2 Pinus taeda isolate 20 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaataacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014320.1|SEG_AY764733S Pinus taeda isolate 12 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764734.1|AY764733S2 Pinus taeda isolate 12 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AH014321.1|SEG_AY764735S Pinus taeda isolate 24 cellulose synthase genes, partial cds
Length = 1023
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764736.1|AY764735S2 Pinus taeda isolate 24 cellulose synthase gene, partial cds
Length = 452
Score = 83.8 bits (42), Expect = 4e-014
Identities = 93/110 (84%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | |||||||||||||| |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|AA556746.1|AA556746 588 Loblolly pine NA Pinus taeda cDNA clone 1NAB10D, mRNA sequence
Length = 546
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 413 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 354
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 353 ttcccccattcggtttt 337
>gb|BE187012.1|BE187012 NXNV_157_H10_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_157_H10 5' similar to Arabidopsis thaliana sequence
At4g18780 cellulose synthase catalytic subunit (IRX1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 477
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 235 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 176
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 175 ttcccccattcggtttt 159
>gb|BE657157.1|BE657157 NXCI_064_G04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_064_G04 5' similar to Arabidopsis
thaliana sequence At4g18780 cellulose synthase catalytic
subunit (IRX1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 463
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 277 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 218
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 217 ttcccccattcggtttt 201
>gb|BE996873.1|BE996873 NXCI_103_E08_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_103_E08 5' similar to Arabidopsis
thaliana sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 363
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 146 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 87
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 86 ttcccccattcggtttt 70
>gb|BQ701215.1|BQ701215 NXSI_023_H05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_023_H05 5' similar to Arabidopsis thaliana
sequence At4g18780 cellulose synthase catalytic subunit
(IRX1) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 492
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 100 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 41
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 40 ttcccccattcggtttt 24
>gb|CD016846.1|CD016846 NXCI_064_H04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_064_H04 5' similar to Arabidopsis
thaliana sequence At4g18780 cellulose synthase catalytic
subunit (IRX1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 162
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 104 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 45
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 44 ttcccccattcggtttt 28
>gb|CF672886.1|CF672886 RTCNT1_74_D05.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_74_D05_A029 5', mRNA sequence
Length = 763
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 354 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 295
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 294 ttcccccattcggtttt 278
>gb|CO169549.1|CO169549 NDL1_7_F09.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_7_F09_A029 5', mRNA sequence
Length = 802
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 112 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 53
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 52 ttcccccattcggtttt 36
Score = 36.2 bits (18), Expect = 7.7
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatc 892
||||| ||||||||||| || || |||||||| || || |||| || ||||||||||
Sbjct: 541 ccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccatc 484
>gb|CX646526.1|CX646526 COLD1_9_H07.g1_A029 Root cold Pinus taeda cDNA clone COLD1_9_H07_A029
5', mRNA sequence
Length = 853
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 135 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 76
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 75 ttcccccattcggtttt 59
Score = 36.2 bits (18), Expect = 7.7
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatc 892
||||| ||||||||||| || || |||||||| || || |||| || ||||||||||
Sbjct: 564 ccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccatc 507
>gb|DR054410.1|DR054410 RTCA1_17_D10.b1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_17_D10_A029 3', mRNA sequence
Length = 821
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Plus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 597 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 656
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 657 ttcccccattcggtttt 673
Score = 36.2 bits (18), Expect = 7.7
Identities = 48/58 (82%)
Strand = Plus / Plus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatc 892
||||| ||||||||||| || || |||||||| || || |||| || ||||||||||
Sbjct: 168 ccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccatc 225
>gb|DR110920.1|DR110920 RTS1_14_B08.b1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_14_B08_A029 3', mRNA sequence
Length = 632
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Plus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 391 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 450
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 451 ttcccccattcggtttt 467
Score = 36.2 bits (18), Expect = 7.7
Identities = 33/38 (86%)
Strand = Plus / Plus
Query: 1045 ggataaacaatggtgttgatgtatgccagtctctccag 1082
||||| || |||||||| ||||||||||||| |||||
Sbjct: 172 ggatagacgatggtgttagtgtatgccagtctttccag 209
>gb|DR118030.1|DR118030 RTMG1_10_E11.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_10_E11_A029 5', mRNA sequence
Length = 700
Score = 81.8 bits (41), Expect = 1e-013
Identities = 113/137 (82%)
Strand = Plus / Minus
Query: 469 gaagcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccatg 528
||||||||||| || ||||| ||||| || || || |||||||| ||||||||||||||
Sbjct: 220 gaagcaagaagaacagaccacacaattacaattgtaggtgtgcgattctgcttccccatc 161
Query: 529 agacccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccg 588
| ||| ||||||||||| || || || | |||||||||| ||||||||||| |||||
Sbjct: 160 aaacctttcaggaaaggatatagatgtacaatcacccagaatgcaaagaacattttccca 101
Query: 589 aatagtggaccccatga 605
|| | |||||||||||
Sbjct: 100 aacaaaggaccccatga 84
>gb|DR163320.1|DR163320 RTFE1_42_F04.b1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_42_F04_A029 3', mRNA sequence
Length = 835
Score = 81.8 bits (41), Expect = 1e-013
Identities = 113/137 (82%)
Strand = Plus / Plus
Query: 469 gaagcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccatg 528
||||||||||| || ||||| ||||| || || || |||||||| ||||||||||||||
Sbjct: 523 gaagcaagaagaacagaccacacaattacaattgtaggtgtgcgattctgcttccccatc 582
Query: 529 agacccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccg 588
| ||| ||||||||||| || || || | |||||||||| ||||||||||| |||||
Sbjct: 583 aaacctttcaggaaaggatatagatgtacaatcacccagaatgcaaagaacattttccca 642
Query: 589 aatagtggaccccatga 605
|| | |||||||||||
Sbjct: 643 aacaaaggaccccatga 659
>gb|DR686101.1|DR686101 EST1076179 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABC32 3' end, mRNA sequence
Length = 737
Score = 81.8 bits (41), Expect = 1e-013
Identities = 155/193 (80%)
Strand = Plus / Minus
Query: 1141 tcaactgaaccaagagcccagcgtaacacttggttgagacgatcagaaagattaattgga 1200
||||| |||||||| ||||| || | |||||| || | |||||| |||||||| |||||
Sbjct: 737 tcaacagaaccaagggcccatcggagcacttgattcaaacgatctgaaagattgattggt 678
Query: 1201 gcagaacccttgaagcaaggccgaagtggcatgcagtagatggatatccaacctcttgca 1260
||||| |||||||| ||| || || |||||||| || || ||||| |||| |||
Sbjct: 677 gcagatcccttgaatgcaggacgtgcaggtatgcagtatattgaaatccagcctcgagca 618
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
||||| || || ||||| ||||||||||| || ||||| ||||| ||||| || ||||||
Sbjct: 617 tgcattttaaacccagtcaaaatatcttctgtgacagaaccataaatccacccaatctct 558
Query: 1321 ttcccccattctg 1333
|| ||||||||||
Sbjct: 557 tttccccattctg 545
Score = 69.9 bits (35), Expect = 6e-010
Identities = 146/183 (79%)
Strand = Plus / Minus
Query: 1691 acaggatcatagccatacaaggcctgcctattgaaacagcatcctgttcccacataaaca 1750
||||||||||| ||||| | || || ||||| || || || ||||| ||||||||||||
Sbjct: 194 acaggatcataaccatagagtgcttgtctattaaagcaacaacctgtacccacataaaca 135
Query: 1751 ggtccttgaatgccatctagacccttcatattaatatcaaagaagacaatgttccggttt 1810
|| ||||| || ||||| | ||| ||| | ||||||||||| ||| |||| || ||
Sbjct: 134 ggcccttggataccatcgaaacctctcaaggtgatatcaaagaacacagtgttacgatta 75
Query: 1811 gcatatcgatcatgcaagtctataccatcaaatctttgtggaaactgaacatagcaagtt 1870
||||||||||| || || || ||||||||||| || |||||||| ||||||||||||
Sbjct: 74 gcatatcgatcgtgtcgatcaatgccatcaaatctctgaggaaactgtacatagcaagtt 15
Query: 1871 ttc 1873
|||
Sbjct: 14 ttc 12
>dbj|BD235989.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 619
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 234 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 175
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 174 ttcccccattcggtttt 158
>gb|AY789650.1| Pinus taeda cellulose synthase catalytic subunit (CesA1) mRNA,
complete cds
Length = 3127
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 2096 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 2037
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 2036 ttcccccattcggtttt 2020
Score = 69.9 bits (35), Expect = 6e-010
Identities = 89/107 (83%)
Strand = Plus / Minus
Query: 2450 tcagaaacataacatgatactttgtcaacagggtaatccacagcaagaatggacaggaca 2509
||||| ||||| || || ||||| || ||||||||||||||||| ||||||||||| ||
Sbjct: 929 tcagagacatagcaagaaactttctccacagggtaatccacagccagaatggacagaacg 870
Query: 2510 gtgttgccagtaattagaggaggttccttaagtggatccactgtact 2556
|||||| | |||| || |||||| || || ||||| ||||| |||||
Sbjct: 869 gtgttggccgtaactaaaggaggctctttcagtgggtccacggtact 823
Score = 60.0 bits (30), Expect = 5e-007
Identities = 87/106 (82%)
Strand = Plus / Minus
Query: 1973 ttcgtcaggacagctgatacgcgaatcaaagcattcatggcaccagccttcttgtggtgc 2032
|||||||| || || || || |||| ||| |||||||||||||| |||||||| ||||||
Sbjct: 1406 ttcgtcagtacggcagagactcgaaccaatgcattcatggcaccggccttcttatggtgc 1347
Query: 2033 tggaagcctggcctcttttcacgagaaacataaacaagccgtggca 2078
|| | || |||| || |||||||| ||||| |||||||| ||||
Sbjct: 1346 tgatacccgggccgtttctcacgagagacatagacaagccggggca 1301
Score = 52.0 bits (26), Expect = 1e-004
Identities = 80/98 (81%)
Strand = Plus / Minus
Query: 1724 aaacagcatcctgttcccacataaacaggtccttgaatgccatctagacccttcatatta 1783
||||| ||||| || |||||||| || || ||||| |||||||| | |||||||| ||
Sbjct: 1655 aaacaacatccagtacccacatacactggcccttggatgccatccaatcccttcatgttg 1596
Query: 1784 atatcaaagaagacaatgttccggtttgcatatcgatc 1821
||||| ||||| ||| |||| || || |||||||||||
Sbjct: 1595 atatcgaagaacacagtgtttcgattggcatatcgatc 1558
Score = 42.1 bits (21), Expect = 0.12
Identities = 63/77 (81%)
Strand = Plus / Minus
Query: 2633 gtttcacggttgataggataccactttgggaactgatctagaagccaagacaaagcaaac 2692
||||| || ||||| |||| |||||| || |||||||| |||| ||| || ||||| |||
Sbjct: 746 gtttcgcgattgatcggattccacttgggaaactgatcaagaatccaggataaagcgaac 687
Query: 2693 caaacttcacaaataac 2709
|| | |||||||||||
Sbjct: 686 cagatctcacaaataac 670
Score = 36.2 bits (18), Expect = 7.7
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatc 892
||||| ||||||||||| || || |||||||| || || |||| || ||||||||||
Sbjct: 2525 ccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccatc 2468
Score = 36.2 bits (18), Expect = 7.7
Identities = 33/38 (86%)
Strand = Plus / Minus
Query: 1045 ggataaacaatggtgttgatgtatgccagtctctccag 1082
||||| || |||||||| ||||||||||||| |||||
Sbjct: 2315 ggatagacgatggtgttagtgtatgccagtctttccag 2278
>gb|AY262815.1| Pinus radiata cellulose synthase (CesA3) mRNA, partial cds
Length = 1333
Score = 81.8 bits (41), Expect = 1e-013
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
|||||||||||||| |||| ||| ||||| || ||||| ||||| |||||||||| ||||
Sbjct: 113 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccgacctct 54
Query: 1321 ttcccccattctgtttt 1337
||||||||||| |||||
Sbjct: 53 ttcccccattcggtttt 37
Score = 36.2 bits (18), Expect = 7.7
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatc 892
||||| ||||||||||| || || |||||||| || || |||| || ||||||||||
Sbjct: 542 ccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccatc 485
>gb|BF778216.1|BF778216 NXSI_083_G10_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_083_G10 5' similar to Arabidopsis thaliana
sequence At4g32410 cellulose synthase catalytic subunit
(RSW1) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 261
Score = 79.8 bits (40), Expect = 6e-013
Identities = 116/144 (80%)
Strand = Plus / Minus
Query: 1999 caaagcattcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgaga 2058
|||||||||||||||||| |||||||| | |||| || || ||||| ||||||||
Sbjct: 250 caaagcattcatggcaccnnnnttcttgtgatnnnggaaaccaggtctcttctcacgaga 191
Query: 2059 aacataaacaagccgtggcaactcattcccatccgtgtcaagcccaccactgtggcccaa 2118
|||||| || ||||| || | |||||| || || || || || || |||||||| |||||
Sbjct: 190 aacatatactagccgaggaagctcattgccttctgtatcgaggccgccactgtgacccaa 131
Query: 2119 gaatacttggatcattccnggatg 2142
||| ||||||||||| || |||||
Sbjct: 130 gaacacttggatcataccaggatg 107
>gb|DR089385.1|DR089385 RTAL1_8_G12.b1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_8_G12_A029 3', mRNA sequence
Length = 751
Score = 79.8 bits (40), Expect = 6e-013
Identities = 82/96 (85%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | |||||||| || ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 96 agaagactggtccacttaaaaacataaagctcagcaaattcaccatcttcatctgaagac 37
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgct 783
||||||||||| || ||||||||||| |||||||||
Sbjct: 36 tttgatgtgacagtaaagtttgtgtcaatccctgct 1
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 338 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 279
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 278 gtgtccggttctg 266
>gb|DR682518.1|DR682518 EST1072593 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAA42, mRNA sequence
Length = 809
Score = 79.8 bits (40), Expect = 6e-013
Identities = 88/104 (84%)
Strand = Plus / Plus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | ||||||||||| ||||| || || ||||| |||||||||||||| | | |
Sbjct: 664 agaagactggtccacttgaaaacatatagttctgcaaagtcaccatcatcatctgaagac 723
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgctagcacttt 791
||||||||||| || || |||||||| ||||||||||| |||||
Sbjct: 724 tttgatgtgacagtaaaatttgtgtcaatccctgctagaacttt 767
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Plus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| || || ||||||||||| | |||||| | ||||||||||||||| || || |
Sbjct: 422 tcacccaaagtagggagaatatggacgaaagaagaatggaccaaacaatgactatagtgg 481
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 482 gtgtccggttctg 494
>gb|AW056552.1|AW056552 ST51E06 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST51E06, mRNA sequence
Length = 389
Score = 75.8 bits (38), Expect = 9e-012
Identities = 68/78 (87%)
Strand = Plus / Minus
Query: 1137 aatttcaactgaaccaagagcccagcgtaacacttggttgagacgatcagaaagattaat 1196
|||||| ||||| ||||||||||| || |||||||| | ||| ||||| || ||||||||
Sbjct: 191 aatttctactgatccaagagcccaacgcaacacttgatggagccgatctgagagattaat 132
Query: 1197 tggagcagaacccttgaa 1214
||||||||| ||||||||
Sbjct: 131 tggagcagatcccttgaa 114
Score = 44.1 bits (22), Expect = 0.032
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatcca 1310
||||| ||||||||||| |||||||| || || || || |||||||||||
Sbjct: 67 tgcattttgaaaccagtcaaaatatcctctgtgactgaaccatatatcca 18
>gb|BX682714.1|BX682714 BX682714 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 120E04 similar to Cellulose synthase, mRNA
sequence
Length = 431
Score = 75.8 bits (38), Expect = 9e-012
Identities = 89/106 (83%)
Strand = Plus / Minus
Query: 1228 ggcatgcagtagatggatatccaacctcttgcatgcatcttgaaaccagttaaaatatct 1287
||||||||||| || || ||||| |||| |||||||| || || ||||| |||||||||
Sbjct: 359 ggcatgcagtatattgaaatccagcctcgagcatgcattttaaacccagtcaaaatatct 300
Query: 1288 tcagtaacagagccatatatccatccgatctctttcccccattctg 1333
|| || ||||| ||||| ||||| || |||||||| ||||||||||
Sbjct: 299 tctgtgacagaaccataaatccacccaatctcttttccccattctg 254
>gb|AH014319.1|SEG_AY764731S Pinus taeda isolate 27 cellulose synthase genes, partial cds
Length = 1023
Score = 75.8 bits (38), Expect = 9e-012
Identities = 92/110 (83%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | ||||||||||| || |||||||| || |||||
Sbjct: 840 acgatggtgggtgttcggttctgcctgcccatgagacctttgaggaaaggatacaggtgc 781
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 780 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 731
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764732.1|AY764731S2 Pinus taeda isolate 27 cellulose synthase gene, partial cds
Length = 452
Score = 75.8 bits (38), Expect = 9e-012
Identities = 92/110 (83%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| ||||| ||||||||| | ||||||||||| || |||||||| || |||||
Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacctttgaggaaaggatacaggtgc 210
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatga 605
| || ||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 209 acaatgacccagaatgcaaagaaaagcttacccaagagaggaccccatga 160
>gb|BX251307.1|BX251307 BX251307 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP048A02, mRNA sequence
Length = 671
Score = 71.9 bits (36), Expect = 1e-010
Identities = 87/104 (83%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | |||||||| || ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 171 agaagactggtccacttaaaaacataaagctcagcaaattcaccatcttcatctgaagac 112
Query: 748 tttgatgtgaccgtgaagtttgtgtcgatccctgctagcacttt 791
|| |||||||| || ||||||||||| |||||||| || |||||
Sbjct: 111 ttcgatgtgacagtaaagtttgtgtcaatccctgccagaacttt 68
Score = 50.1 bits (25), Expect = 5e-004
Identities = 43/49 (87%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaat 494
||||||| ||||| ||||||||||| |||||||| | |||||||||||
Sbjct: 413 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaat 365
>gb|AA556522.1|AA556522 377 Loblolly pine C Pinus taeda cDNA clone 3C11G, mRNA sequence
Length = 718
Score = 69.9 bits (35), Expect = 6e-010
Identities = 89/107 (83%)
Strand = Plus / Minus
Query: 2450 tcagaaacataacatgatactttgtcaacagggtaatccacagcaagaatggacaggaca 2509
||||| ||||| || || ||||| || ||||||||||||||||| ||||||||||| ||
Sbjct: 416 tcagagacatagcaagaaactttctccacagggtaatccacagccagaatggacagaacg 357
Query: 2510 gtgttgccagtaattagaggaggttccttaagtggatccactgtact 2556
|||||| | |||| || |||||| || || ||||| ||||| |||||
Sbjct: 356 gtgttggccgtaactaaaggaggctctttcagtgggtccacggtact 310
Score = 42.1 bits (21), Expect = 0.12
Identities = 63/77 (81%)
Strand = Plus / Minus
Query: 2633 gtttcacggttgataggataccactttgggaactgatctagaagccaagacaaagcaaac 2692
||||| || ||||| |||| |||||| || |||||||| |||| ||| || ||||| |||
Sbjct: 233 gtttcgcgattgatcggattccacttgggaaactgatcaagaatccaggataaagcgaac 174
Query: 2693 caaacttcacaaataac 2709
|| | |||||||||||
Sbjct: 173 cagatctcacaaataac 157
>gb|AA556640.1|AA556640 495 Loblolly pine C Pinus taeda cDNA clone 2C7G, mRNA sequence
Length = 537
Score = 67.9 bits (34), Expect = 2e-009
Identities = 156/197 (79%)
Strand = Plus / Minus
Query: 2368 tttcttgcaaaagggaacccatttccttgcaaactctgcggtttcagatagagcttcaaa 2427
||||||||| || || |||||||| || ||||| |||| ||| ||||| |||| ||||||
Sbjct: 227 tttcttgcagaatggtacccattttctggcaaattctgaggtctcagagagagattcaaa 168
Query: 2428 agtcaacatagctgaaccgtcatcagaaacataacatgatactttgtcaacagggtaatc 2487
||| | ||| | | ||||||||||| |||||||| || || ||||| |||||||| ||
Sbjct: 167 agtaagcatngacgctccgtcatcagagacataacaggacacattgtctacagggtagtc 108
Query: 2488 cacagcaagaatggacaggacagtgttgccagtaattagaggaggttccttaagtggatc 2547
|| | ||| || || | || || ||| |||||| | |||||| ||||| ||||||||
Sbjct: 107 tactgaaaggattgataatactgtattggcagtaaccaaaggaggctccttcagtggatc 48
Query: 2548 cactgtactaacaaaga 2564
||| ||||| |||||||
Sbjct: 47 cacagtactcacaaaga 31
>gb|BE762150.1|BE762150 NXCI_082_D03_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_082_D03 5' similar to Arabidopsis
thaliana sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 238
Score = 67.9 bits (34), Expect = 2e-009
Identities = 92/112 (82%)
Strand = Plus / Minus
Query: 469 gaagcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccatg 528
||||||||||| || ||||| ||| || || || |||||||| ||||||||||||||
Sbjct: 117 gaagcaagaagaacagaccacnnaattacaattgtaggtgtgcgattctgcttccccatc 58
Query: 529 agacccttcaggaaagggtagaggtggaggatcacccagattgcaaagaaca 580
| ||| ||||||||||| || || || | |||||||||| |||||||||||
Sbjct: 57 aaacctttcaggaaaggatatagatgtacaatcacccagaatgcaaagaaca 6
>gb|CD024597.1|CD024597 NXRV056_C03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV056_C03 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 190
Score = 67.9 bits (34), Expect = 2e-009
Identities = 58/66 (87%)
Strand = Plus / Minus
Query: 1729 gcatcctgttcccacataaacaggtccttgaatgccatctagacccttcatattaatatc 1788
|||||| ||||||||||| ||||| |||||||| ||||| ||||| ||||| || |||||
Sbjct: 84 gcatccagttcccacatatacaggcccttgaattccatccagacctttcatgttgatatc 25
Query: 1789 aaagaa 1794
||||||
Sbjct: 24 aaagaa 19
>gb|DR169086.1|DR169086 RTPHOS1_30_A02.b1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_30_A02_A029 3', mRNA sequence
Length = 640
Score = 67.9 bits (34), Expect = 2e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcga 894
||||| ||||||| |||||||||||||||||| || || || ||||| |||||||||||
Sbjct: 537 ccaatcacccaaagctgctcatttctccaccagtcatcgataccaaccccactccatcgc 478
Query: 895 agctccaaaa 904
| ||||||||
Sbjct: 477 atctccaaaa 468
Score = 42.1 bits (21), Expect = 0.12
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 951 agcataattgctaatcgcaggaataataaattt 983
|||||||||||||||| | ||||| ||||||||
Sbjct: 421 agcataattgctaatctctggaattataaattt 389
>gb|CF478399.1|CF478399 RTWW3_18_G11.g1_A022 Well-watered loblolly pine roots WW3 Pinus taeda
cDNA clone RTWW3_18_G11_A022 5', mRNA sequence
Length = 717
Score = 65.9 bits (33), Expect = 9e-009
Identities = 147/185 (79%)
Strand = Plus / Minus
Query: 1030 gggatagatgtaattggataaacaatggtgttgatgtatgccagtctctccagaagcttt 1089
|||||||| || || |||||||| | ||||| |||||||| || |||||||| ||
Sbjct: 225 gggatagaagtgatgggataaactgtagtgtttatgtatgctagcctctccagccatttc 166
Query: 1090 agccttccattgtaaccataccagataggacagtgtctgctaagtagaatttcaactgaa 1149
||||||||| ||||||||||| || ||||| || | ||| || ||||||||||| |||
Sbjct: 165 agccttccaccataaccataccaaattggacaatgacggctgagaagaatttcaacagaa 106
Query: 1150 ccaagagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaaccc 1209
|| | ||||| || | |||||||| | ||||||||||||||| || |||||||| ||
Sbjct: 105 cccaatgcccatcgaagtacttggttcaaacgatcagaaagatttataggagcagaccct 46
Query: 1210 ttgaa 1214
|||||
Sbjct: 45 ttgaa 41
Score = 58.0 bits (29), Expect = 2e-006
Identities = 155/197 (78%)
Strand = Plus / Minus
Query: 697 gtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcctttgatgtg 756
||||| ||||||| ||||| ||| |||||||| || || ||||| | || || ||||||
Sbjct: 558 gtccatttgaacagatacaactctgcaaaatctccgtcttcatctgaagctttcgatgtg 499
Query: 757 accgtgaagtttgtgtcgatccctgctagcacttttaagagaccttggaacacagcaaag 816
|| |||||||||||||| || || || || ||||| | | || |||| || ||||||
Sbjct: 498 acagtgaagtttgtgtcaataccggcaaggactttcagcaacccctggacgactgcaaag 439
Query: 817 agatgtgcagaggtgccaccaatgacccaaaactgctcatttctccaccaatcctcaatg 876
||||| || || || ||||||||||| || || ||||| |||||||| || |||||
Sbjct: 438 agatgagctgacacacctccaatgacccagaattgttcattcctccaccattcatcaata 379
Query: 877 ccaacaccactccatcg 893
||||| |||||||||||
Sbjct: 378 ccaaccccactccatcg 362
>gb|AW698152.1|AW698152 NXNV_073_G04_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_073_G04 5', mRNA sequence
Length = 240
Score = 63.9 bits (32), Expect = 3e-008
Identities = 110/137 (80%)
Strand = Plus / Minus
Query: 469 gaagcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccatg 528
||||||||||| || ||||| ||||| || || || |||||||| || |||||||||
Sbjct: 210 gaagcaagaagaacagaccacacaattacaattgtaggtgtgcgattnnncttccccatc 151
Query: 529 agacccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccg 588
| ||| ||||||||||| || || || | |||||||||| ||||||||||| |||||
Sbjct: 150 aaacctttcaggaaaggatatagatgtacaatcacccagaatgcaaagaacattttccca 91
Query: 589 aatagtggaccccatga 605
|| | |||||||||||
Sbjct: 90 aacaaaggaccccatga 74
>gb|CD020879.1|CD020879 NXNV_092_D05_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_092_D05 5' similar to Arabidopsis thaliana
sequence At5g05170 cellulose synthase catalytic subunit
(Ath-B) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 198
Score = 63.9 bits (32), Expect = 3e-008
Identities = 71/84 (84%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcc 747
|||||| | |||||||| || ||||| ||||||||||| |||||||| ||||| | | |
Sbjct: 84 agaagactggtccacttaaaaacataaagctcagcaaattcaccatcttcatctgaagac 25
Query: 748 tttgatgtgaccgtgaagtttgtg 771
||||||||||| || |||||||||
Sbjct: 24 tttgatgtgacagtaaagtttgtg 1
>gb|CD027901.1|CD027901 NXNV_073_G04 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_073_G04 5' similar to Arabidopsis thaliana sequence
At5g17420 cellulose synthase catalytic subunit (IRX3)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 240
Score = 63.9 bits (32), Expect = 3e-008
Identities = 110/137 (80%)
Strand = Plus / Minus
Query: 469 gaagcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccatg 528
||||||||||| || ||||| ||||| || || || |||||||| || |||||||||
Sbjct: 210 gaagcaagaagaacagaccacacaattacaattgtaggtgtgcgattnnncttccccatc 151
Query: 529 agacccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccg 588
| ||| ||||||||||| || || || | |||||||||| ||||||||||| |||||
Sbjct: 150 aaacctttcaggaaaggatatagatgtacaatcacccagaatgcaaagaacattttccca 91
Query: 589 aatagtggaccccatga 605
|| | |||||||||||
Sbjct: 90 aacaaaggaccccatga 74
>gb|BF169757.1|BF169757 NXCI_128_G07_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_128_G07 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 345
Score = 61.9 bits (31), Expect = 1e-007
Identities = 155/197 (78%)
Strand = Plus / Minus
Query: 2368 tttcttgcaaaagggaacccatttccttgcaaactctgcggtttcagatagagcttcaaa 2427
||||||||| || || |||||||| || ||||| |||| ||| ||||| |||| ||||||
Sbjct: 261 tttcttgcagaatggtacccattttctggcaaattctgaggtctcagagagagattcaaa 202
Query: 2428 agtcaacatagctgaaccgtcatcagaaacataacatgatactttgtcaacagggtaatc 2487
||| | ||| | ||||||||||| |||||||| || || ||||| |||||||| ||
Sbjct: 201 agtaagcatnnacgctccgtcatcagagacataacaggacacattgtctacagggtagtc 142
Query: 2488 cacagcaagaatggacaggacagtgttgccagtaattagaggaggttccttaagtggatc 2547
|| | ||| || || | || || ||| |||||| | |||||| ||||| ||||||||
Sbjct: 141 tactgaaaggattgataatactgtattggcagtaaccaaaggaggctccttcagtggatc 82
Query: 2548 cactgtactaacaaaga 2564
||| ||||| |||||||
Sbjct: 81 cacagtactcacaaaga 65
>gb|CD022890.1|CD022890 NXPV_089_B01_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_089_B01 5' similar to Arabidopsis
thaliana sequence At5g64740 cellulose synthase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 151
Score = 61.9 bits (31), Expect = 1e-007
Identities = 70/83 (84%)
Strand = Plus / Minus
Query: 2450 tcagaaacataacatgatactttgtcaacagggtaatccacagcaagaatggacaggaca 2509
||||| ||||| || || ||||| || ||||||||||||||||| ||||||||||| ||
Sbjct: 90 tcagagacatagcaagaaactttctccacagggtaatccacagccagaatggacagaacg 31
Query: 2510 gtgttgccagtaattagaggagg 2532
|||||| | |||| || ||||||
Sbjct: 30 gtgttggccgtaactaaaggagg 8
>gb|DR059226.1|DR059226 RTNIT1_16_B01.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_16_B01_A029 5', mRNA sequence
Length = 237
Score = 61.9 bits (31), Expect = 1e-007
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 853 tcatttctccaccaatcctcaatgccaacaccactccatcgaagctccaaaataccagt 911
||||||||||||||||| ||||| ||||| |||||||||| | |||||||| ||||||
Sbjct: 237 tcatttctccaccaatcatcaataccaaccgcactccatcgcatctccaaaacaccagt 179
Score = 42.1 bits (21), Expect = 0.12
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 951 agcataattgctaatcgcaggaataataaattt 983
|||||||||||||||| | ||||| ||||||||
Sbjct: 139 agcataattgctaatctctggaattataaattt 107
>gb|BQ695964.1|BQ695964 NXPV_034_H04_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_034_H04 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 568
Score = 60.0 bits (30), Expect = 5e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagg 545
|||||||| ||||| ||||||||| | |||||||||||||| ||||||||
Sbjct: 54 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaagg 5
>gb|BQ698119.1|BQ698119 NXPV_064_G05_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_064_G05 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 512
Score = 60.0 bits (30), Expect = 5e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagg 545
|||||||| ||||| ||||||||| | |||||||||||||| ||||||||
Sbjct: 54 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaagg 5
>gb|BQ698366.1|BQ698366 NXPV_069_A10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_069_A10 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 405
Score = 60.0 bits (30), Expect = 5e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagg 545
|||||||| ||||| ||||||||| | |||||||||||||| ||||||||
Sbjct: 54 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaagg 5
>gb|CD023046.1|CD023046 NXPV_098_A07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_098_A07 5' similar to Arabidopsis
thaliana sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 129
Score = 60.0 bits (30), Expect = 5e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagg 545
|||||||| ||||| ||||||||| | |||||||||||||| ||||||||
Sbjct: 54 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaagg 5
>gb|DR101934.1|DR101934 STRR1_76_G04.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_76_G04_A033 5', mRNA sequence
Length = 579
Score = 60.0 bits (30), Expect = 5e-007
Identities = 108/134 (80%)
Strand = Plus / Minus
Query: 1733 cctgttcccacataaacaggtccttgaatgccatctagacccttcatattaatatcaaag 1792
||||| || ||||| | |||||| || || ||||| ||||| ||||| || |||||||||
Sbjct: 183 cctgtaccaacatatataggtccctgtattccatccagacctttcatgtttatatcaaag 124
Query: 1793 aagacaatgttccggtttgcatatcgatcatgcaagtctataccatcaaatctttgtgga 1852
|| ||| | || || || ||||||| ||||||| | || ||||||||||| || || ||
Sbjct: 123 aacacagtattgcgattggcatatctatcatgccaatcaataccatcaaacctctgaggg 64
Query: 1853 aactgaacatagca 1866
||||| ||||||||
Sbjct: 63 aactgcacatagca 50
>gb|AW495797.1|AW495797 NXNV_065_E11_FF Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_065_E11_F 5', mRNA sequence
Length = 347
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 86 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 27
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 26 gtgtccggttctg 14
>gb|BQ291066.1|BQ291066 NXRV055_C03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV055_C03 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 630
Score = 58.0 bits (29), Expect = 2e-006
Identities = 50/57 (87%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccat 891
||||| ||||| ||||||||||| |||||||| || ||||||||||| || ||||||
Sbjct: 76 ccaatcacccagaactgctcattcctccaccattcatcaatgccaaccccgctccat 20
>gb|CD027755.1|CD027755 NXNV_065_E11_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_065_E11 5' similar to Arabidopsis thaliana
sequence At5g05170 cellulose synthase catalytic subunit
(Ath-B) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 347
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 86 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 27
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 26 gtgtccggttctg 14
>gb|CF668299.1|CF668299 RTCNT1_35_D11.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_35_D11_A029 5', mRNA sequence
Length = 769
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 2006 ttcatggcaccagccttcttgtggtgctggaagcctggcctcttttcacgagaaacataa 2065
||||||||||| || |||||||||||||| | || || ||||| ||||||||||||||
Sbjct: 687 ttcatggcaccggctttcttgtggtgctgatatccaggtctcttctcacgagaaacatag 628
Query: 2066 acaag 2070
|||||
Sbjct: 627 acaag 623
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 2519 gtaattagaggaggttccttaagtggatccactgtactaacaaaga 2564
||||| |||||||| || || ||||||||||||||||| |||||||
Sbjct: 174 gtaatcagaggaggctctttcagtggatccactgtactcacaaaga 129
Score = 50.1 bits (25), Expect = 5e-004
Identities = 136/173 (78%)
Strand = Plus / Minus
Query: 2240 actttgaactcttcatactccctcttcatagcccgcctttctttcacaaaagaaggttgt 2299
||||||||||||||||| || | ||||| || |||| ||||| ||||| | |||||
Sbjct: 453 actttgaactcttcatattctcgtttcatggcacgccgctcttttacaaaggtcggttgc 394
Query: 2300 attttgtcctttaggtaatctatctttcgagcaaagtaaaactctggagccctaggttca 2359
| ||||| || |||||||| || ||| ||| ||||||||| || || |||| ||| ||
Sbjct: 393 accttgtctttcaggtaatcaattttttgagaaaagtaaaaatcgggggcccgaggctct 334
Query: 2360 atgttgtgtttcttgcaaaagggaacccatttccttgcaaactctgcggtttc 2412
|| ||| || ||||| || ||||||||||||| |||||||||| ||||||
Sbjct: 333 atactgtactttttgcagaaaggaacccatttccgggcaaactctgaggtttc 281
>gb|CO369885.1|CO369885 RTK1_55_A04.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_55_A04_A029 3', mRNA sequence
Length = 768
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 290 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 231
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 230 gtgtccggttctg 218
Score = 46.1 bits (23), Expect = 0.008
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 688 agaagagttgtccacttgaacacatacagctcagcaaaatcaccatc 734
|||||| | |||||||| || ||||| ||||||||||| ||||||||
Sbjct: 48 agaagactggtccacttaaaaacataaagctcagcaaattcaccatc 2
>gb|CV031645.1|CV031645 RTNACL1_2_G07.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_2_G07_A029 5', mRNA sequence
Length = 796
Score = 58.0 bits (29), Expect = 2e-006
Identities = 155/197 (78%)
Strand = Plus / Minus
Query: 697 gtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcctttgatgtg 756
||||| ||||||| ||||| ||| |||||||| || || ||||| | || || ||||||
Sbjct: 387 gtccatttgaacagatacaactctgcaaaatctccgtcttcatctgaagctttcgatgtg 328
Query: 757 accgtgaagtttgtgtcgatccctgctagcacttttaagagaccttggaacacagcaaag 816
|| |||||||||||||| || || || || ||||| | | || |||| || ||||||
Sbjct: 327 acagtgaagtttgtgtcaataccggcaaggactttcagcaacccctggacgactgcaaag 268
Query: 817 agatgtgcagaggtgccaccaatgacccaaaactgctcatttctccaccaatcctcaatg 876
||||| || || || ||||||||||| || || ||||| |||||||| || |||||
Sbjct: 267 agatgagctgacacacctccaatgacccagaattgttcattcctccaccattcatcaata 208
Query: 877 ccaacaccactccatcg 893
||||| |||||||||||
Sbjct: 207 ccaaccccactccatcg 191
Score = 36.2 bits (18), Expect = 7.7
Identities = 57/70 (81%)
Strand = Plus / Minus
Query: 535 ttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaatagt 594
|||||||||||||| || |||| |||||||| | ||||| || || || ||||| ||
Sbjct: 549 ttcaggaaagggtaaagatggacaatcacccaaaacgcaaaaaagagttttccgaacagg 490
Query: 595 ggaccccatg 604
||||||||||
Sbjct: 489 ggaccccatg 480
>gb|DR162195.1|DR162195 RTFE1_16_G12.b1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_16_G12_A029 3', mRNA sequence
Length = 626
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 1150 ccaagagcccagcgtaacacttggttgagacgatcagaaagattaattggagcagaaccc 1209
||||||||||| || || ||||||| |||||||| || ||||||||||||||||| ||
Sbjct: 3 ccaagagcccaacgcaaaacttggtgtagacgatctgagagattaattggagcagaccct 62
Query: 1210 ttgaa 1214
|||||
Sbjct: 63 ttgaa 67
Score = 46.1 bits (23), Expect = 0.008
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1260 atgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctc 1319
|||||| ||||| || || || ||||| || ||||| || ||||| |||||||| | |||
Sbjct: 113 atgcattttgaagcctgtcaatatatcctctgtaaccgaaccataaatccatccaacctc 172
Query: 1320 tttcccccattctgttttatcctcata 1346
|| ||||| ||||||||||| |||||
Sbjct: 173 ctttccccagtctgttttatcttcata 199
>gb|DR744391.1|DR744391 RTCU1_22_E01.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_22_E01_A029 3', mRNA sequence
Length = 631
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 156 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 97
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 96 gtgtccggttctg 84
>gb|DR746030.1|DR746030 RTCU1_34_F01.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_34_F01_A029 3', mRNA sequence
Length = 711
Score = 58.0 bits (29), Expect = 2e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| ||||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 209 tcacccaaagcagggagaatatggacgcaagaagaattgaccaaacaataactattgttg 150
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 149 gtgtccggttctg 137
>gb|BF609349.1|BF609349 NXSI_045_C06_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_045_C06 5' similar to Arabidopsis thaliana
sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 296
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 224 ccatatatccatccgatctcctttccccattcagttttctcctc 181
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 95 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 37
>gb|BF777175.1|BF777175 NXSI_066_C05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_066_C05 5' similar to Arabidopsis thaliana
sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 342
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 140 ccatatatccatccgatctcctttccccattcagttttctcctc 97
>gb|BF778225.1|BF778225 NXSI_083_H07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_083_H07 5' similar to Arabidopsis thaliana
sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 421
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 53 ccatatatccatccgatctcctttccccattcagttttctcctc 10
>gb|BG275715.1|BG275715 NXSI_145_B01_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_145_B01 5' similar to Arabidopsis thaliana
sequence At4g18780 cellulose synthase catalytic subunit
(IRX1) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 487
Score = 56.0 bits (28), Expect = 8e-006
Identities = 100/124 (80%)
Strand = Plus / Minus
Query: 1698 catagccatacaaggcctgcctattgaaacagcatcctgttcccacataaacaggtcctt 1757
|||||||||| | ||| || || || ||||| ||||| || |||||||| || || ||||
Sbjct: 300 catagccatagagggcttgtctgttaaaacaacatccagtacccacatacactggccctt 241
Query: 1758 gaatgccatctagacccttcatattaatatcaaagaagacaatgttccggtttgcatatc 1817
| |||||||| | |||||||| || ||||| ||||| ||| |||| || || |||||||
Sbjct: 240 ggatgccatccaatcccttcatgttgatatcgaagaacacagtgtttcgattggcatatc 181
Query: 1818 gatc 1821
||||
Sbjct: 180 gatc 177
>gb|CD022200.1|CD022200 NXPV_024_F02_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_024_F02 5' similar to Arabidopsis
thaliana sequence At4g32410 cellulose synthase catalytic
subunit (RSW1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 181
Score = 56.0 bits (28), Expect = 8e-006
Identities = 80/98 (81%)
Strand = Plus / Minus
Query: 2045 ctcttttcacgagaaacataaacaagccgtggcaactcattcccatccgtgtcaagccca 2104
||||| |||||||||||||| || ||||| || | |||||| | || || || || ||
Sbjct: 175 ctcttctcacgagaaacatatactagccgaggaagctcattgncttctgtatcgaggccg 116
Query: 2105 ccactgtggcccaagaatacttggatcattccnggatg 2142
|||||||| |||||||| ||||||||||| || |||||
Sbjct: 115 ccactgtgacccaagaacacttggatcataccaggatg 78
>gb|CF396363.1|CF396363 RTDS2_21_F06.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_21_F06_A021 5', mRNA sequence
Length = 716
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 160 ccatatatccatccgatctcctttccccattcagttttctcctc 117
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 661 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 602
Query: 859 ctcca 863
|||||
Sbjct: 601 ctcca 597
>gb|CO369344.1|CO369344 RTK1_46_B01.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_46_B01_A029 5', mRNA sequence
Length = 709
Score = 56.0 bits (28), Expect = 8e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgttttatcctc 1343
|||||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 178 ccatatatccatccgatctcctttccccattcagttttctcctc 135
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 679 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 620
Query: 859 ctcca 863
|||||
Sbjct: 619 ctcca 615
>gb|AW985238.1|AW985238 NXNV_132_G11_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_132_G11 5' similar to Arabidopsis thaliana sequence
At4g39350 cellulose synthase catalytic subunit (Ath-A)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 425
Score = 54.0 bits (27), Expect = 3e-005
Identities = 105/131 (80%)
Strand = Plus / Minus
Query: 1775 ttcatattaatatcaaagaagacaatgttccggtttgcatatcgatcatgcaagtctata 1834
|||||||| ||||| ||||| || | ||| || || ||||| ||||| ||| || |||
Sbjct: 307 ttcatattgatatcgaagaaaaccacgttgcgattggcataacgatcgtgcctatcaata 248
Query: 1835 ccatcaaatctttgtggaaactgaacatagcaagttttccttcctagtgctggatccatc 1894
||||||||||| ||||||||||| ||||| || |||| |||| | | |||||||||
Sbjct: 247 ccatcaaatctctgtggaaactgcacataacagactttctttccaacagtaggatccatc 188
Query: 1895 atgaaacacat 1905
|||||||||||
Sbjct: 187 atgaaacacat 177
>gb|BE431393.1|BE431393 NXNV_181_F12_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_181_F12 5' similar to Arabidopsis thaliana
sequence At5g05170 cellulose synthase catalytic subunit
(Ath-B) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 210
Score = 54.0 bits (27), Expect = 3e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaac 881
||||| |||||||| |||||||| |||||||| || |||||||||||
Sbjct: 151 ccaataacccaaaattgctcattcctccaccattcatcaatgccaac 105
>gb|BV079715.1| Pp_CesA3 Pinus pinaster megagametophytes Pinus pinaster STS genomic,
sequence tagged site
Length = 488
Score = 54.0 bits (27), Expect = 3e-005
Identities = 48/55 (87%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccga 1315
|||||||||||||| |||| ||| ||||| || ||||| ||||| ||||||||||
Sbjct: 305 tgcatcttgaaacctgttagaatgtcttctgtcacagaaccatagatccatccga 251
>gb|AW011234.1|AW011234 ST18D02 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST18D02, mRNA sequence
Length = 599
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgtttt 1337
|||||||||||||||||||| || |||||||| |||||
Sbjct: 50 ccatatatccatccgatctcctttccccattcagtttt 13
Score = 40.1 bits (20), Expect = 0.49
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 808 acagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcatttctcca 863
|||||||| ||||| |||||| || ||||||||||| ||||| || ||||||||
Sbjct: 542 acagcaaaaagatgagcagagacccctccaatgacccagaactgttcgtttctcca 487
>gb|BF186171.1|BF186171 NXCI_133_H05_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_133_H05 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 209
Score = 52.0 bits (26), Expect = 1e-004
Identities = 53/62 (85%)
Strand = Plus / Minus
Query: 1973 ttcgtcaggacagctgatacgcgaatcaaagcattcatggcaccagccttcttgtggtgc 2032
|||||||| || || || || |||| ||| |||||||||||||| |||||||| ||||||
Sbjct: 65 ttcgtcagtacggcagagactcgaaccaatgcattcatggcaccggccttcttatggtgc 6
Query: 2033 tg 2034
||
Sbjct: 5 tg 4
>gb|BG275945.1|BG275945 NXSI_149_G12_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_149_G12 5' similar to Arabidopsis thaliana
sequence At4g18780 cellulose synthase catalytic subunit
(IRX1) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 530
Score = 52.0 bits (26), Expect = 1e-004
Identities = 80/98 (81%)
Strand = Plus / Minus
Query: 1724 aaacagcatcctgttcccacataaacaggtccttgaatgccatctagacccttcatatta 1783
||||| ||||| || |||||||| || || ||||| |||||||| | |||||||| ||
Sbjct: 150 aaacaacatccagtacccacatacactggcccttggatgccatccaatcccttcatgttg 91
Query: 1784 atatcaaagaagacaatgttccggtttgcatatcgatc 1821
||||| ||||| ||| |||| || || |||||||||||
Sbjct: 90 atatcgaagaacacagtgtttcgattggcatatcgatc 53
>gb|BQ698872.1|BQ698872 NXRV116_D12_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV116_D12 5' similar to Arabidopsis thaliana
sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 685
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 2519 gtaattagaggaggttccttaagtggatccactgtactaacaaaga 2564
||||| |||||||| || || ||||||||||||||||| |||||||
Sbjct: 385 gtaatcagaggaggctctttcagtggatccactgtactcacaaaga 340
Score = 42.1 bits (21), Expect = 0.12
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 2372 ttgcaaaagggaacccatttccttgcaaactctgcggtttc 2412
||||| || ||||||||||||| |||||||||| ||||||
Sbjct: 532 ttgcagaaaggaacccatttccgggcaaactctgaggtttc 492
>gb|BQ700148.1|BQ700148 NXRV101_G08_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV101_G08 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 566
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 2519 gtaattagaggaggttccttaagtggatccactgtactaacaaaga 2564
||||| |||||||| || || ||||||||||||||||| |||||||
Sbjct: 385 gtaatcagaggaggctctttcagtggatccactgtactcacaaaga 340
>gb|AY262814.1| Pinus radiata cellulose synthase (CesA11) mRNA, partial cds
Length = 1258
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctctttcccccattctgtttt 1337
|||||||||||||||||||| || |||||||| |||||
Sbjct: 47 ccatatatccatccgatctcctttccccattcggtttt 10
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 548 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 489
Query: 859 ctcca 863
|||||
Sbjct: 488 ctcca 484
>gb|AW870284.1|AW870284 NXNV_128_H04_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_128_H04 5' similar to Arabidopsis thaliana sequence
At5g05170 cellulose synthase catalytic subunit (Ath-B)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 300
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 1717 cctattgaaacagcatcctgttcccacataaac 1749
|||||||||||| |||||||| |||||||||||
Sbjct: 198 cctattgaaacaacatcctgtacccacataaac 166
Score = 36.2 bits (18), Expect = 7.7
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 1886 ggatccatcatgaaacacatagcctc 1911
||||||||||| |||||||| |||||
Sbjct: 29 ggatccatcataaaacacatggcctc 4
>gb|BE209216.1|BE209216 NXNV_147_D10_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_147_D10 5' similar to Arabidopsis thaliana
sequence At5g05170 cellulose synthase catalytic subunit
(Ath-B) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 411
Score = 50.1 bits (25), Expect = 5e-004
Identities = 64/77 (83%)
Strand = Plus / Minus
Query: 697 gtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcctttgatgtg 756
||||| ||||||| ||||| ||| |||||||| || || ||||| | || || ||||||
Sbjct: 119 gtccatttgaacagatacaactctgcaaaatctccgtcttcatctgaagctttcgatgtg 60
Query: 757 accgtgaagtttgtgtc 773
|| ||||||||||||||
Sbjct: 59 acagtgaagtttgtgtc 43
Score = 36.2 bits (18), Expect = 7.7
Identities = 57/70 (81%)
Strand = Plus / Minus
Query: 535 ttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaatagt 594
|||||||||||||| || |||| |||||||| | ||||| || || || ||||| ||
Sbjct: 281 ttcaggaaagggtaaagatggacaatcacccaaaacgcaaaaaagagttttccgaacagg 222
Query: 595 ggaccccatg 604
||||||||||
Sbjct: 221 ggaccccatg 212
>gb|BM493879.1|BM493879 NXLV_071_A06_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_071_A06 5' similar to Arabidopsis thaliana
sequence At5g05170 cellulose synthase catalytic subunit
(Ath-B) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 276
Score = 50.1 bits (25), Expect = 5e-004
Identities = 61/73 (83%)
Strand = Plus / Minus
Query: 446 tcacccacagcagcgagaatatggaagcaagaaggacggaccaaacaatgacgatggtcg 505
||||||| |||| ||||||||||| |||||||| | ||||||||||| || || || |
Sbjct: 173 tcacccaaagcaaggagaatatggacgcaagaagaattgaccaaacaataactattgttg 114
Query: 506 gtgtgcggttctg 518
|||| ||||||||
Sbjct: 113 gtgtccggttctg 101
>gb|CF478733.1|CF478733 RTWW3_16_G10.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_16_G10_A022 5', mRNA sequence
Length = 695
Score = 50.1 bits (25), Expect = 5e-004
Identities = 64/77 (83%)
Strand = Plus / Minus
Query: 697 gtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcctttgatgtg 756
||||| ||||||| ||||| ||| |||||||| || || ||||| | || || ||||||
Sbjct: 115 gtccatttgaacagatacaactctgcaaaatctccgtcttcatctgaagctttcgatgtg 56
Query: 757 accgtgaagtttgtgtc 773
|| ||||||||||||||
Sbjct: 55 acagtgaagtttgtgtc 39
Score = 36.2 bits (18), Expect = 7.7
Identities = 57/70 (81%)
Strand = Plus / Minus
Query: 535 ttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaatagt 594
|||||||||||||| || |||| |||||||| | ||||| || || || ||||| ||
Sbjct: 277 ttcaggaaagggtaaagatggacaatcacccaaaacgcaaaaaagagttttccgaacagg 218
Query: 595 ggaccccatg 604
||||||||||
Sbjct: 217 ggaccccatg 208
>gb|DR096386.1|DR096386 STRR1_27_D08.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_27_D08_A033 5', mRNA sequence
Length = 744
Score = 50.1 bits (25), Expect = 5e-004
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 697 gtccacttgaacacatacagctcagcaaaatcaccatcatcatcggttgcctttgatgtg 756
||||| ||||||| ||||| ||| |||||||| || || ||||| | || || ||||||
Sbjct: 659 gtccatttgaacagatacaactctgcaaaatctccgtcttcatctgaagctttcgatgtg 718
Query: 757 accgtgaagtttgtgtc 773
|| ||||||||||||||
Sbjct: 719 acagtgaagtttgtgtc 735
Score = 36.2 bits (18), Expect = 7.7
Identities = 57/70 (81%)
Strand = Plus / Plus
Query: 535 ttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaatagt 594
|||||||||||||| || |||| |||||||| | ||||| || || || ||||| ||
Sbjct: 497 ttcaggaaagggtaaagatggacaatcacccaaaacgcaaaaaagagttttccgaacagg 556
Query: 595 ggaccccatg 604
||||||||||
Sbjct: 557 ggaccccatg 566
>gb|AW290811.1|AW290811 NXNV047B05F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV047B05 5', mRNA sequence
Length = 433
Score = 48.1 bits (24), Expect = 0.002
Identities = 45/52 (86%)
Strand = Plus / Minus
Query: 1258 gcatgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatcc 1309
|||||||| || || ||||| ||||||||||| || ||||| ||||||||||
Sbjct: 428 gcatgcattttaaagccagtcaaaatatcttctgtcacagaaccatatatcc 377
>gb|CD027470.1|CD027470 NXNV047B05 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV047B05 5' similar to Arabidopsis thaliana sequence
At5g05170 cellulose synthase catalytic subunit (Ath-B)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 433
Score = 48.1 bits (24), Expect = 0.002
Identities = 45/52 (86%)
Strand = Plus / Minus
Query: 1258 gcatgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatcc 1309
|||||||| || || ||||| ||||||||||| || ||||| ||||||||||
Sbjct: 428 gcatgcattttaaagccagtcaaaatatcttctgtcacagaaccatatatcc 377
>gb|DR687054.1|DR687054 EST1077132 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABM78 3' end, mRNA sequence
Length = 740
Score = 48.1 bits (24), Expect = 0.002
Identities = 75/92 (81%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
|||||||| |||||||| | ||||||||| || ||||| |||||||| || || |||
Sbjct: 298 ccttggaaaacagcaaacaaatgtgcagacacacctccaatcacccaaaattgttcgttt 239
Query: 859 ctccaccaatcctcaatgccaacaccactcca 890
|||||||| || ||||| ||||||||||||
Sbjct: 238 ctccaccagtcatcaattggaacaccactcca 207
>gb|DT633819.1|DT633819 EST1148750 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFZ11 3' end, mRNA sequence
Length = 688
Score = 48.1 bits (24), Expect = 0.002
Identities = 75/92 (81%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
|||||||| |||||||| | ||||||||| || ||||| |||||||| || || |||
Sbjct: 306 ccttggaaaacagcaaacaaatgtgcagacacacctccaatcacccaaaattgttcgttt 247
Query: 859 ctccaccaatcctcaatgccaacaccactcca 890
|||||||| || ||||| ||||||||||||
Sbjct: 246 ctccaccagtcatcaattggaacaccactcca 215
>gb|AW289733.1|AW289733 NXNV005B08F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV005B08 5', mRNA sequence
Length = 253
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 140 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 82
Score = 42.1 bits (21), Expect = 0.12
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggag 1568
||||||||||||| ||| ||||| || ||||| | | ||||||||||||
Sbjct: 59 tcgtaaccttcaagtccttcttcaatctcttcgaggctgaagatgggag 11
>gb|BX000643.1|BX000643 BX000643 Pinus pinaster xylem Pinus pinaster cDNA clone PPJM13, mRNA
sequence
Length = 520
Score = 46.1 bits (23), Expect = 0.008
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
||||||||||| ||||| | ||| || || || || || ||||| |||||||| | ||||
Sbjct: 473 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 414
Query: 1321 ttcccccattctgttttatcctcatat 1347
|| |||||||| ||||| || ||||||
Sbjct: 413 tttccccattccgttttgtcttcatat 387
>gb|BF516632.1|BF516632 NXSI_001_D01_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_001_D01 5' similar to Arabidopsis thaliana
sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 439
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 321 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 263
Score = 44.1 bits (22), Expect = 0.032
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggagc 1569
||||||||||||| ||| ||||| || ||||| | | |||||||||||||
Sbjct: 240 tcgtaaccttcaagtccttcttcaatctcttcgaggctgaagatgggagc 191
>gb|BG317558.1|BG317558 NXPV_003_B08_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_003_B08 5' similar to Arabidopsis
thaliana sequence At5g05170 cellulose synthase catalytic
subunit (Ath-B) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 536
Score = 46.1 bits (23), Expect = 0.008
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 405 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 346
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 345 aacacntggttcaaacggtctgatagattgattggagcagaccctttgaa 296
Score = 46.1 bits (23), Expect = 0.008
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
||||||||||| ||||| | ||| || || || || || ||||| |||||||| | ||||
Sbjct: 249 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 190
Query: 1321 ttcccccattctgttttatcctcatat 1347
|| |||||||| ||||| || ||||||
Sbjct: 189 tttccccattccgttttgtcttcatat 163
>gb|BI202889.1|BI202889 NXPV_091_H09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_091_H09 5' similar to Arabidopsis
thaliana sequence At5g05170 cellulose synthase catalytic
subunit (Ath-B) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 537
Score = 46.1 bits (23), Expect = 0.008
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
||||||||||| ||||| | ||| || || || || || ||||| |||||||| | ||||
Sbjct: 249 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 190
Query: 1321 ttcccccattctgttttatcctcatat 1347
|| |||||||| ||||| || ||||||
Sbjct: 189 tttccccattccgttttgtcttcatat 163
>gb|CD021726.1|CD021726 NXNV_159_F12_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_159_F12 5' similar to Arabidopsis thaliana sequence
At5g44030 cellulose synthase catalytic subunit-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 174
Score = 46.1 bits (23), Expect = 0.008
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 1294 acagagccatatatccatccgatctctttcccccattctgtttt 1337
||||| ||||| |||||||||| ||||||||||||| |||||
Sbjct: 156 acagaaccatagatccatccgannnctttcccccattcggtttt 113
>gb|CD028293.1|CD028293 NXNV005B08 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV005B08 5' similar to Arabidopsis thaliana sequence
At5g44030 cellulose synthase catalytic subunit-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 253
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 1442 gtggatgcaataaaaattggagactggccaaagcgtttctccaagctcttctgagacat 1500
||||||| |||||| | |||||||||||||| | ||| || ||||||||||| |||||
Sbjct: 140 gtggatgtaataaagacaggagactggccaaatcttttttcaaagctcttctgcgacat 82
Score = 42.1 bits (21), Expect = 0.12
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 1520 tcgtaaccttcaaatccctcttctatatcttccatgttgaagatgggag 1568
||||||||||||| ||| ||||| || ||||| | | ||||||||||||
Sbjct: 59 tcgtaaccttcaagtccttcttcaatctcttcgaggctgaagatgggag 11
>gb|DR163407.1|DR163407 RTFE1_42_F04.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_42_F04_A029 5', mRNA sequence
Length = 913
Score = 46.1 bits (23), Expect = 0.008
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 469 gaagcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccat 527
||||| ||||| || ||||| ||||| || || || |||||||| ||||||||||||||
Sbjct: 847 gaagctagaagaacagaccacacaattacaattgtaggtgtgcgattctgcttccccat 905
>gb|DR695127.1|DR695127 EST1085220 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEK81 3' end, mRNA sequence
Length = 800
Score = 46.1 bits (23), Expect = 0.008
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 828 ggtgccaccaatgacccaaaactgctcatttctccacca 866
|||||| ||||| | ||| ||||||||||||||||||||
Sbjct: 772 ggtgcctccaatcaaccagaactgctcatttctccacca 734
>gb|BV079717.1| Pp_CesA7 Pinus pinaster megagametophytes Pinus pinaster STS genomic,
sequence tagged site
Length = 560
Score = 46.1 bits (23), Expect = 0.008
Identities = 56/67 (83%)
Strand = Plus / Minus
Query: 1886 ggatccatcatgaaacacatagcctctctaagagctttgctgctattgaagtagtgatca 1945
||||||||||| || ||||| || || | || || |||||| |||||| ||||||||||
Sbjct: 120 ggatccatcataaagcacattgcttcgcgaacggccttgctgttattgacgtagtgatca 61
Query: 1946 caatcca 1952
|||||||
Sbjct: 60 caatcca 54
>gb|BF517368.1|BF517368 NXSI_013_F11_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_013_F11 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 332
Score = 44.1 bits (22), Expect = 0.032
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 1973 ttcgtcaggacagctgatacgcgaatcaaagcattcatggcaccagccttcttgtggt 2030
|||||||| || || || || |||| ||| |||||||||||||| |||||||| ||||
Sbjct: 58 ttcgtcagtacggcagagactcgaaccaatgcattcatggcaccggccttcttatggt 1
Score = 36.2 bits (18), Expect = 7.7
Identities = 42/50 (84%)
Strand = Plus / Minus
Query: 1772 cccttcatattaatatcaaagaagacaatgttccggtttgcatatcgatc 1821
|||||||| || ||||| ||||| ||| |||| || || |||||||||||
Sbjct: 259 cccttcatgttgatatcgaagaacacagtgtttcgattggcatatcgatc 210
>gb|BF609760.1|BF609760 NXSI_050_B03_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_050_B03 5' similar to Arabidopsis thaliana
sequence At2g21770 putative cellulose synthase catalytic
subunit see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 546
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 131 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 72
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 71 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 22
>gb|DR118589.1|DR118589 RTMG1_18_A07.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_18_A07_A029 3', mRNA sequence
Length = 610
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Plus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 354 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 413
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 414 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 463
Score = 40.1 bits (20), Expect = 0.49
Identities = 62/76 (81%)
Strand = Plus / Plus
Query: 1261 tgcatcttgaaaccagttaaaatatcttcagtaacagagccatatatccatccgatctct 1320
||||||||||| ||||| | ||| || || || || || ||||| |||||||| | ||||
Sbjct: 510 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 569
Query: 1321 ttcccccattctgttt 1336
|| |||||||| ||||
Sbjct: 570 tttccccattccgttt 585
Score = 40.1 bits (20), Expect = 0.49
Identities = 65/80 (81%)
Strand = Plus / Plus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcga 894
||||| ||||| ||||| ||||||| |||||| || ||||||| || |||||||| |
Sbjct: 84 ccaataacccagaactgttcatttcgccaccattcttcaatgctcactccactccacctc 143
Query: 895 agctccaaaataccagtggc 914
| |||| ||||||||||||
Sbjct: 144 atttccagaataccagtggc 163
>gb|AY764673.1|AY764673S1 Pinus taeda isolate 11 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764675.1|AY764675S1 Pinus taeda isolate 16 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764677.1|AY764677S1 Pinus taeda isolate 25 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764679.1|AY764679S1 Pinus taeda isolate 7 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764681.1|AY764681S1 Pinus taeda isolate 6 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764683.1|AY764683S1 Pinus taeda isolate 4 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764685.1|AY764685S1 Pinus taeda isolate 26 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764687.1|AY764687S1 Pinus taeda isolate 9 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764689.1|AY764689S1 Pinus taeda isolate 23 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764691.1|AY764691S1 Pinus taeda isolate 13 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764693.1|AY764693S1 Pinus taeda isolate 30 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764695.1|AY764695S1 Pinus taeda isolate 22 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764697.1|AY764697S1 Pinus taeda isolate 32 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764699.1|AY764699S1 Pinus taeda isolate 18 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764701.1|AY764701S1 Pinus taeda isolate 10 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764703.1|AY764703S1 Pinus taeda isolate 14 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764705.1|AY764705S1 Pinus taeda isolate 21 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764707.1|AY764707S1 Pinus taeda isolate 31 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764709.1|AY764709S1 Pinus taeda isolate 5 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764711.1|AY764711S1 Pinus taeda isolate 2 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764713.1|AY764713S1 Pinus taeda isolate 3 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764715.1|AY764715S1 Pinus taeda isolate 19 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764717.1|AY764717S1 Pinus taeda isolate 28 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764719.1|AY764719S1 Pinus taeda isolate 17 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764721.1|AY764721S1 Pinus taeda isolate 8 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764723.1|AY764723S1 Pinus taeda isolate 15 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764725.1|AY764725S1 Pinus taeda isolate 1 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764727.1|AY764727S1 Pinus taeda isolate 29 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764729.1|AY764729S1 Pinus taeda isolate 20 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764731.1|AY764731S1 Pinus taeda isolate 27 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764733.1|AY764733S1 Pinus taeda isolate 12 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AY764735.1|AY764735S1 Pinus taeda isolate 24 cellulose synthase gene, partial cds
Length = 571
Score = 44.1 bits (22), Expect = 0.032
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 486 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 427
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcagaacccttgaa 1214
||||| ||||| | ||| || || ||||| ||||||||||| || |||||
Sbjct: 426 aacacctggttcaaacggtctgatagattgattggagcagaccctttgaa 377
>gb|AW289623.1|AW289623 NXNV003H02F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV003H02 5', mRNA sequence
Length = 508
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 298 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 239
Query: 859 ctcca 863
|||||
Sbjct: 238 ctcca 234
>gb|BX249614.1|BX249614 BX249614 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP026B12, mRNA sequence
Length = 685
Score = 42.1 bits (21), Expect = 0.12
Identities = 99/125 (79%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| || |||||||| ||| ||||||||||| || ||||| || || | |||
Sbjct: 659 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 600
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatgattggtagcca 615
|| |||||||| | || || |||| |||||| || || || |||||||| |||||||||
Sbjct: 599 agaatcacccatactgagaaaaacaacttcccaaacagaggtccccatgactggtagcca 540
Query: 616 ctgtt 620
||||
Sbjct: 539 ttgtt 535
Score = 36.2 bits (18), Expect = 7.7
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatc 892
||||| ||||||||||| || || |||||||| || || |||| || ||||||||||
Sbjct: 323 ccaatcacccaaaactgttcgttcctccaccattcttcgatgcttactccactccatc 266
>gb|BX250234.1|BX250234 BX250234 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP034A11, mRNA sequence
Length = 689
Score = 42.1 bits (21), Expect = 0.12
Identities = 81/101 (80%)
Strand = Plus / Minus
Query: 1105 ccataccagataggacagtgtctgctaagtagaatttcaactgaaccaagagcccagcgt 1164
||||||||||| || || |||||||| | | |||||| ||||| || | |||||| ||
Sbjct: 221 ccataccagattgggcaatgtctgctcatgaaaatttctactgatcccaaagcccaacgc 162
Query: 1165 aacacttggttgagacgatcagaaagattaattggagcaga 1205
||||| ||||| | ||| || || ||||| |||||||||||
Sbjct: 161 aacacctggttcaaacggtctgatagattgattggagcaga 121
Score = 40.1 bits (20), Expect = 0.49
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcga 894
||||| ||||| ||||| ||||||| |||||| || ||||||| || |||||||| |
Sbjct: 491 ccaataacccagaactgttcatttcgccaccattcttcaatgctcactccactccacctc 432
Query: 895 agctccaaaataccagtggc 914
| |||| ||||||||||||
Sbjct: 431 atttccagaataccagtggc 412
>gb|BX250396.1|BX250396 BX250396 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP036D07 similar to Cellulose synthase
catalytic subunit, mRNA sequence
Length = 585
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 409 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 350
Query: 859 ctcca 863
|||||
Sbjct: 349 ctcca 345
>gb|BX252761.1|BX252761 BX252761 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP070C12 similar to Cellulose synthase
catalytic subunit, mRNA sequence
Length = 650
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 112 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 53
Query: 859 ctcca 863
|||||
Sbjct: 52 ctcca 48
>gb|BX254022.1|BX254022 BX254022 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP092C09, mRNA sequence
Length = 690
Score = 42.1 bits (21), Expect = 0.12
Identities = 99/125 (79%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| || |||||||| ||| ||||||||||| || ||||| || || | |||
Sbjct: 608 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 549
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatgattggtagcca 615
|| |||||||| | || || |||| |||||| || || || |||||||| |||||||||
Sbjct: 548 agaatcacccatactgagaaaaacaacttcccaaacagaggtccccatgactggtagcca 489
Query: 616 ctgtt 620
||||
Sbjct: 488 ttgtt 484
Score = 36.2 bits (18), Expect = 7.7
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatc 892
||||| ||||||||||| || || |||||||| || || |||| || ||||||||||
Sbjct: 272 ccaatcacccaaaactgttcgttcctccaccattcttcgatgcttactccactccatc 215
>gb|BX254483.1|BX254483 BX254483 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP099B08, mRNA sequence
Length = 707
Score = 42.1 bits (21), Expect = 0.12
Identities = 99/125 (79%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| || |||||||| ||| ||||||||||| || ||||| || || | |||
Sbjct: 321 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 262
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatgattggtagcca 615
|| |||||||| | || || |||| |||||| || || || |||||||| |||||||||
Sbjct: 261 agaatcacccatactgagaaaaacaacttcccaaacagaggtccccatgactggtagcca 202
Query: 616 ctgtt 620
||||
Sbjct: 201 ttgtt 197
>gb|BX254948.1|BX254948 BX254948 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP108A02, mRNA sequence
Length = 673
Score = 42.1 bits (21), Expect = 0.12
Identities = 99/125 (79%)
Strand = Plus / Minus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| || |||||||| ||| ||||||||||| || ||||| || || | |||
Sbjct: 259 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 200
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatgattggtagcca 615
|| |||||||| | || || |||| |||||| || || || |||||||| |||||||||
Sbjct: 199 agaatcacccatactgagaaaaacaacttcccaaacagaggtccccatgactggtagcca 140
Query: 616 ctgtt 620
||||
Sbjct: 139 ttgtt 135
>gb|BX255349.1|BX255349 BX255349 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP004G04, mRNA sequence
Length = 561
Score = 42.1 bits (21), Expect = 0.12
Identities = 99/125 (79%)
Strand = Plus / Plus
Query: 496 acgatggtcggtgtgcggttctgcttccccatgagacccttcaggaaagggtagaggtgg 555
|||||||| || |||||||| ||| ||||||||||| || ||||| || || | |||
Sbjct: 328 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 387
Query: 556 aggatcacccagattgcaaagaacagcttcccgaatagtggaccccatgattggtagcca 615
|| |||||||| | || || |||| |||||| || || || |||||||| |||||||||
Sbjct: 388 agaatcacccatactgagaaaaacaacttcccaaacagaggtccccatgactggtagcca 447
Query: 616 ctgtt 620
||||
Sbjct: 448 ttgtt 452
>gb|BX255542.1|BX255542 BX255542 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP007A04 similar to Cellulose synthase
catalytic subunit, mRNA sequence
Length = 696
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 484 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 425
Query: 859 ctcca 863
|||||
Sbjct: 424 ctcca 420
>gb|BE643725.1|BE643725 NXCI_043_H03_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_043_H03 5' similar to Arabidopsis
thaliana sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 323
Score = 42.1 bits (21), Expect = 0.12
Identities = 81/101 (80%)
Strand = Plus / Minus
Query: 2240 actttgaactcttcatactccctcttcatagcccgcctttctttcacaaaagaaggttgt 2299
|||||||||||||||||||| | ||||| || |||| ||||| ||||| | |||||
Sbjct: 108 actttgaactcttcatactctcgtttcatggcacgccgctcttttacaaaggtcggttgc 49
Query: 2300 attttgtcctttaggtaatctatctttcgagcaaagtaaaa 2340
| ||||| || |||||||| || ||| ||| |||||||||
Sbjct: 48 accttgtctttcaggtaatcaattttttgagaaaagtaaaa 8
Score = 36.2 bits (18), Expect = 7.7
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 2045 ctcttttcacgagaaacataaacaag 2070
||||| |||||||||||||| |||||
Sbjct: 303 ctcttctcacgagaaacatagacaag 278
>gb|BE643804.1|BE643804 NXCI_047_D12_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_047_D12 5' similar to Arabidopsis
thaliana sequence At4g18780 cellulose synthase catalytic
subunit (IRX1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 290
Score = 42.1 bits (21), Expect = 0.12
Identities = 63/77 (81%)
Strand = Plus / Minus
Query: 2633 gtttcacggttgataggataccactttgggaactgatctagaagccaagacaaagcaaac 2692
||||| || ||||| |||| |||||| || |||||||| |||| ||| || ||||| |||
Sbjct: 192 gtttcgcgattgatcggattccacttgggaaactgatcaagaatccaggataaagcgaac 133
Query: 2693 caaacttcacaaataac 2709
|| | |||||||||||
Sbjct: 132 cagatctcacaaataac 116
>gb|CD028231.1|CD028231 NXNV003H02 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV003H02 5' similar to Arabidopsis thaliana sequence
At5g44030 cellulose synthase catalytic subunit-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 508
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 298 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 239
Query: 859 ctcca 863
|||||
Sbjct: 238 ctcca 234
>gb|DR110657.1|DR110657 RTS1_12_E03.b1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_12_E03_A029 3', mRNA sequence
Length = 815
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 329 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 388
Query: 859 ctcca 863
|||||
Sbjct: 389 ctcca 393
>gb|DR110744.1|DR110744 RTS1_12_E03.g1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_12_E03_A029 5', mRNA sequence
Length = 847
Score = 42.1 bits (21), Expect = 0.12
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
||||| || |||||||| ||||| |||||| || ||||||||||| ||||| || |||
Sbjct: 653 ccttgaaaaacagcaaaaagatgagcagagacccctccaatgacccagaactgttcgttt 712
Query: 859 ctcca 863
|||||
Sbjct: 713 ctcca 717
>gb|AW290647.1|AW290647 NXNV044E04F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV044E04 5', mRNA sequence
Length = 327
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 562 acccagattgcaaagaacagcttcccgaatagtggaccccatga 605
||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 314 acccagaatgcaaagaaaagcttacccaagagaggaccccatga 271
>gb|AW698302.1|AW698302 NXNV_071_E11_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_071_E11 5' similar to Arabidopsis thaliana sequence
At5g44030 cellulose synthase catalytic subunit-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 339
Score = 40.1 bits (20), Expect = 0.49
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctc 1319
||||||||||||||||||||
Sbjct: 20 ccatatatccatccgatctc 1
>gb|AW784057.1|AW784057 NXNV_117_B10_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_117_B10 5' similar to Arabidopsis thaliana sequence
At5g44030 cellulose synthase catalytic subunit-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 528
Score = 40.1 bits (20), Expect = 0.49
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctc 1319
||||||||||||||||||||
Sbjct: 20 ccatatatccatccgatctc 1
>gb|BE123803.1|BE123803 NXNV_156_F02_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_156_F02 5' similar to Arabidopsis thaliana sequence
At5g44030 cellulose synthase catalytic subunit-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 332
Score = 40.1 bits (20), Expect = 0.49
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1300 ccatatatccatccgatctc 1319
||||||||||||||||||||
Sbjct: 20 ccatatatccatccgatctc 1
>gb|BE451860.1|BE451860 NXCI_004_B09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_004_B09 5' similar to Arabidopsis
thaliana sequence At4g18780 cellulose synthase catalytic
subunit (IRX1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 279
Score = 40.1 bits (20), Expect = 0.49
Identities = 32/37 (86%)
Strand = Plus / Minus
Query: 1301 catatatccatccgatctctttcccccattctgtttt 1337
|||| |||||||||| ||||||||||||| |||||
Sbjct: 237 catagatccatccgannnctttcccccattcggtttt 201
>gb|BF220717.1|BF220717 NXCI_149_G02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_149_G02 5' similar to Arabidopsis
thaliana sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 527
Score = 40.1 bits (20), Expect = 0.49
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 808 acagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcatttctcca 863
|||||||| ||||| |||||| || ||||||||||| ||||| || ||||||||
Sbjct: 469 acagcaaaaagatgagcagagacccctccaatgacccagaactgttcgtttctcca 414
>gb|BF221043.1|BF221043 NXCI_162_E11_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_162_E11 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 529
Score = 40.1 bits (20), Expect = 0.49
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcga 894
||||| ||||| ||||| ||||||| |||||| || ||||||| || |||||||| |
Sbjct: 257 ccaataacccagaactgttcatttcgccaccattcttcaatgctcactccactccacctc 198
Query: 895 agctccaaaataccagtggc 914
| |||| ||||||||||||
Sbjct: 197 atttccagaataccagtggc 178
>gb|BG673833.1|BG673833 NXPV_075_F11_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_075_F11 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 439
Score = 40.1 bits (20), Expect = 0.49
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcga 894
||||| ||||| ||||| ||||||| |||||| || ||||||| || |||||||| |
Sbjct: 204 ccaataacccagaactgttcatttcgccaccattcttcaatgctcactccactccacctc 145
Query: 895 agctccaaaataccagtggc 914
| |||| ||||||||||||
Sbjct: 144 atttccagaataccagtggc 125
>gb|CD027309.1|CD027309 NXNV044E04 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV044E04 5' similar to Arabidopsis thaliana sequence
At5g17420 cellulose synthase catalytic subunit (IRX3)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 327
Score = 40.1 bits (20), Expect = 0.49
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 562 acccagattgcaaagaacagcttcccgaatagtggaccccatga 605
||||||| ||||||||| ||||| || || || |||||||||||
Sbjct: 314 acccagaatgcaaagaaaagcttacccaagagaggaccccatga 271
>gb|CF390276.1|CF390276 RTDR2_18_A03.g1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_18_A03_A021 5', mRNA
sequence
Length = 465
Score = 40.1 bits (20), Expect = 0.49
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 835 ccaatgacccaaaactgctcatttctccaccaatcctcaatgccaacaccactccatcga 894
||||| ||||| ||||| ||||||| |||||| || ||||||| || |||||||| |
Sbjct: 311 ccaataacccagaactgttcatttcgccaccattcttcaatgctcactccactccacctc 252
Query: 895 agctccaaaataccagtggc 914
| |||| ||||||||||||
Sbjct: 251 atttccagaataccagtggc 232
>gb|DR100267.1|DR100267 STRR1_62_H11.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_62_H11_A033 5', mRNA sequence
Length = 549
Score = 40.1 bits (20), Expect = 0.49
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 847 aactgctcatttctccacca 866
||||||||||||||||||||
Sbjct: 133 aactgctcatttctccacca 114
>gb|DR160218.1|DR160218 RTFE1_4_D09.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_4_D09_A029 5', mRNA sequence
Length = 756
Score = 40.1 bits (20), Expect = 0.49
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 847 aactgctcatttctccacca 866
||||||||||||||||||||
Sbjct: 429 aactgctcatttctccacca 410
>gb|DR684943.1|DR684943 EST1075020 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAY38 3' end, mRNA sequence
Length = 859
Score = 40.1 bits (20), Expect = 0.49
Identities = 74/92 (80%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
|||||||| |||||||| | ||||||||| || ||||| |||||||| || || |||
Sbjct: 203 ccttggaaaacagcaaacaaatgtgcagacacacctccaatcacccaaaattgttcgttt 144
Query: 859 ctccaccaatcctcaatgccaacaccactcca 890
||||||| || ||||| ||||||||||||
Sbjct: 143 ctccacctgtcatcaattggaacaccactcca 112
>gb|DT632612.1|DT632612 EST1147543 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFL85 3' end, mRNA sequence
Length = 771
Score = 40.1 bits (20), Expect = 0.49
Identities = 74/92 (80%)
Strand = Plus / Minus
Query: 799 ccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgctcattt 858
|||||||| |||||||| | ||||||||| || ||||| |||||||| || || |||
Sbjct: 211 ccttggaaaacagcaaacaaatgtgcagacacacctccaatcacccaaaattgttcgttt 152
Query: 859 ctccaccaatcctcaatgccaacaccactcca 890
||||||| || ||||| ||||||||||||
Sbjct: 151 ctccacctgtcatcaattggaacaccactcca 120
Database: Pinus_nucl_with_EST.fasta
Posted date: May 2, 2006 3:25 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 310,230
Number of Sequences: 355925
Number of extensions: 310230
Number of successful extensions: 83359
Number of sequences better than 10.0: 342
Number of HSP's better than 10.0 without gapping: 337
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 82401
Number of HSP's gapped (non-prelim): 935
length of query: 2856
length of database: 217,277,237
effective HSP length: 20
effective length of query: 2836
effective length of database: 210,158,737
effective search space: 596010178132
effective search space used: 596010178132
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)