BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804918.2.3
(985 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF387891.1|CF387891 RTDR1_18_F09.g1_A015 Loblolly pine r... 129 2e-028
gb|CO175804.1|CO175804 NDL1_57_D06.b1_A029 Needles control ... 129 2e-028
gb|CO367528.1|CO367528 RTK1_34_G11.g1_A029 Roots minus pota... 129 2e-028
gb|DN460695.1|DN460695 EST956494 Sequencing ESTs from loblo... 129 2e-028
gb|DN462689.1|DN462689 EST958488 Sequencing ESTs from loblo... 129 2e-028
gb|DR025028.1|DR025028 STRS1_69_D08.b1_A034 Shoot tip pitch... 129 2e-028
gb|DR093099.1|DR093099 STRR1_6_B07.b1_A033 Stem Response Re... 129 2e-028
gb|DR093169.1|DR093169 STRR1_6_B07.g1_A033 Stem Response Re... 129 2e-028
gb|DR099634.1|DR099634 STRR1_57_B02.b1_A033 Stem Response R... 129 2e-028
gb|DR099694.1|DR099694 STRR1_57_B02.g1_A033 Stem Response R... 129 2e-028
gb|DR178936.1|DR178936 RTMNUT1_14_H08.g1_A029 Roots minus m... 129 2e-028
gb|DR180061.1|DR180061 RTMNUT1_26_E12.b1_A029 Roots minus m... 129 2e-028
gb|DR180143.1|DR180143 RTMNUT1_26_E12.g1_A029 Roots minus m... 129 2e-028
gb|CF400481.1|CF400481 RTWW1_5_F02.g1_A015 Well-watered lob... 125 4e-027
gb|CF671997.1|CF671997 RTCNT1_60_D07.g1_A029 Root control P... 125 4e-027
gb|DR016208.1|DR016208 STRS1_8_C03.g1_A034 Shoot tip pitch ... 125 4e-027
gb|DR019892.1|DR019892 STRS1_33_E03.b1_A034 Shoot tip pitch... 125 4e-027
gb|DR021389.1|DR021389 STRS1_44_G08.b1_A034 Shoot tip pitch... 125 4e-027
gb|DR101560.1|DR101560 STRR1_74_E03.b1_A033 Stem Response R... 125 4e-027
gb|DR101629.1|DR101629 STRR1_74_E03.g1_A033 Stem Response R... 125 4e-027
gb|DR178852.1|DR178852 RTMNUT1_14_H08.b1_A029 Roots minus m... 125 4e-027
gb|CF386306.1|CF386306 RTDR1_13_D11.g1_A015 Loblolly pine r... 121 6e-026
gb|CF400139.1|CF400139 RTWW1_3_H05.g1_A015 Well-watered lob... 121 6e-026
gb|CF400303.1|CF400303 RTWW1_4_E12.g1_A015 Well-watered lob... 121 6e-026
gb|CF400876.1|CF400876 RTWW1_8_B05.g1_A015 Well-watered lob... 121 6e-026
gb|CF663680.1|CF663680 RTCNT1_4_B03.g1_A029 Root control Pi... 121 6e-026
gb|CO174224.1|CO174224 NDL1_42_D01.g1_A029 Needles control ... 121 6e-026
gb|CO411231.1|CO411231 EST841616 Sequencing ESTs from loblo... 121 6e-026
gb|CO413491.1|CO413491 EST843876 Sequencing ESTs from loblo... 121 6e-026
gb|CV137973.1|CV137973 EST849182 Sequencing ESTs from loblo... 121 6e-026
gb|CV138881.1|CV138881 EST850090 Sequencing ESTs from loblo... 121 6e-026
gb|CV145594.1|CV145594 EST856803 Sequencing ESTs from loblo... 121 6e-026
gb|CV147649.1|CV147649 EST858858 Sequencing ESTs from loblo... 121 6e-026
gb|DN446958.1|DN446958 EST942757 Sequencing ESTs from loblo... 121 6e-026
gb|DN447788.1|DN447788 EST943587 Sequencing ESTs from loblo... 121 6e-026
gb|DN451081.1|DN451081 EST946880 Sequencing ESTs from loblo... 121 6e-026
gb|DN455453.1|DN455453 EST951252 Sequencing ESTs from loblo... 121 6e-026
gb|DN457081.1|DN457081 EST952880 Sequencing ESTs from loblo... 121 6e-026
gb|DN457605.1|DN457605 EST953404 Sequencing ESTs from loblo... 121 6e-026
gb|DN462207.1|DN462207 EST958006 Sequencing ESTs from loblo... 121 6e-026
gb|DN462754.1|DN462754 EST958553 Sequencing ESTs from loblo... 121 6e-026
gb|DR025491.1|DR025491 STRS1_71_H12.g1_A034 Shoot tip pitch... 121 6e-026
gb|DR071133.1|DR071133 RTDK1_17_G08.g1_A029 Roots, dark Pin... 121 6e-026
gb|DR080326.1|DR080326 RTFEPL1_21_H11.g1_A029 Roots plus ad... 121 6e-026
gb|DR096503.1|DR096503 STRR1_28_H08.b1_A033 Stem Response R... 121 6e-026
gb|DR112603.1|DR112603 RTS1_29_G02.b1_A029 Roots minus sulf... 121 6e-026
gb|DT624423.1|DT624423 EST1158698 Sequencing ESTs from lobl... 121 6e-026
gb|BX248907.1|BX248907 BX248907 Pinus pinaster differenciat... 117 9e-025
gb|CF667142.1|CF667142 RTCNT1_28_A04.g1_A029 Root control P... 117 9e-025
gb|BX675171.1|BX675171 BX675171 RN Pinus pinaster cDNA clon... 117 9e-025
gb|BX681480.1|BX681480 BX681480 RS Pinus pinaster cDNA clon... 117 9e-025
gb|CV135118.1|CV135118 EST846327 Sequencing ESTs from loblo... 117 9e-025
gb|CX650205.1|CX650205 COLD1_44_D12.b1_A029 Root cold Pinus... 117 9e-025
gb|DR112678.1|DR112678 RTS1_29_G02.g1_A029 Roots minus sulf... 117 9e-025
gb|DR181297.1|DR181297 RTMNUT1_38_B07.b2_A029 Roots minus m... 117 9e-025
gb|CN783902.1|CN783902 EST782593 Sequencing ESTs from loblo... 115 4e-024
gb|CO201181.1|CO201181 RTCNT2_4_D06.b1_A029 Root control 2 ... 115 4e-024
gb|CO361282.1|CO361282 NDL2_3_H08.g1_A029 Needles control 2... 115 4e-024
gb|CV133908.1|CV133908 EST845117 Sequencing ESTs from loblo... 115 4e-024
gb|CV135319.1|CV135319 EST846528 Sequencing ESTs from loblo... 115 4e-024
gb|CV136622.1|CV136622 EST847831 Sequencing ESTs from loblo... 115 4e-024
gb|CV137349.1|CV137349 EST848558 Sequencing ESTs from loblo... 115 4e-024
gb|CV137492.1|CV137492 EST848701 Sequencing ESTs from loblo... 115 4e-024
gb|CV137856.1|CV137856 EST849065 Sequencing ESTs from loblo... 115 4e-024
gb|CV138543.1|CV138543 EST849752 Sequencing ESTs from loblo... 115 4e-024
gb|CV139095.1|CV139095 EST850304 Sequencing ESTs from loblo... 115 4e-024
gb|CV143521.1|CV143521 EST854730 Sequencing ESTs from loblo... 115 4e-024
gb|CV146001.1|CV146001 EST857210 Sequencing ESTs from loblo... 115 4e-024
gb|CV146320.1|CV146320 EST857529 Sequencing ESTs from loblo... 115 4e-024
gb|CV147265.1|CV147265 EST858474 Sequencing ESTs from loblo... 115 4e-024
gb|CX652139.1|CX652139 COLD1_57_E03.b1_A029 Root cold Pinus... 115 4e-024
gb|DN445694.1|DN445694 EST941493 Sequencing ESTs from loblo... 115 4e-024
gb|DN453114.1|DN453114 EST948913 Sequencing ESTs from loblo... 115 4e-024
gb|DN456589.1|DN456589 EST952388 Sequencing ESTs from loblo... 115 4e-024
gb|DN457898.1|DN457898 EST953697 Sequencing ESTs from loblo... 115 4e-024
gb|DN457925.1|DN457925 EST953724 Sequencing ESTs from loblo... 115 4e-024
gb|DN458115.1|DN458115 EST953914 Sequencing ESTs from loblo... 115 4e-024
gb|DN459101.1|DN459101 EST954900 Sequencing ESTs from loblo... 115 4e-024
gb|DN463808.1|DN463808 EST959607 Sequencing ESTs from loblo... 115 4e-024
gb|DN464277.1|DN464277 EST960076 Sequencing ESTs from loblo... 115 4e-024
gb|DN465502.1|DN465502 EST961301 Sequencing ESTs from loblo... 115 4e-024
gb|DN465684.1|DN465684 EST961483 Sequencing ESTs from loblo... 115 4e-024
gb|DR070033.1|DR070033 RTDK1_10_H02.g1_A029 Roots, dark Pin... 115 4e-024
gb|DT625015.1|DT625015 EST1159290 Sequencing ESTs from lobl... 115 4e-024
gb|DT627235.1|DT627235 EST1160311 Sequencing ESTs from lobl... 115 4e-024
gb|BE520104.1|BE520104 NXCI_016_H05_F NXCI (Nsf Xylem Compr... 113 1e-023
gb|BG275381.1|BG275381 NXSI_141_C02_F NXSI (Nsf Xylem Side ... 113 1e-023
gb|CF474118.1|CF474118 RTWW2_18_F04.g1_A021 Well-watered lo... 113 1e-023
gb|CF672186.1|CF672186 RTCNT1_62_A03.b1_A029 Root control P... 113 1e-023
gb|CN784034.1|CN784034 EST782725 Sequencing ESTs from loblo... 113 1e-023
gb|CN785978.1|CN785978 EST784669 Sequencing ESTs from loblo... 113 1e-023
gb|CO410745.1|CO410745 EST841130 Sequencing ESTs from loblo... 113 1e-023
gb|CO411901.1|CO411901 EST842286 Sequencing ESTs from loblo... 113 1e-023
gb|CO412528.1|CO412528 EST842913 Sequencing ESTs from loblo... 113 1e-023
gb|CV134043.1|CV134043 EST845252 Sequencing ESTs from loblo... 113 1e-023
gb|CV136664.1|CV136664 EST847873 Sequencing ESTs from loblo... 113 1e-023
gb|CV136875.1|CV136875 EST848084 Sequencing ESTs from loblo... 113 1e-023
gb|CV138026.1|CV138026 EST849235 Sequencing ESTs from loblo... 113 1e-023
gb|CV139126.1|CV139126 EST850335 Sequencing ESTs from loblo... 113 1e-023
gb|CV143875.1|CV143875 EST855084 Sequencing ESTs from loblo... 113 1e-023
gb|CV145549.1|CV145549 EST856758 Sequencing ESTs from loblo... 113 1e-023
gb|CV147500.1|CV147500 EST858709 Sequencing ESTs from loblo... 113 1e-023
gb|CV147701.1|CV147701 EST858910 Sequencing ESTs from loblo... 113 1e-023
gb|CX651365.1|CX651365 COLD1_51_H03.g1_A029 Root cold Pinus... 113 1e-023
gb|DN446023.1|DN446023 EST941822 Sequencing ESTs from loblo... 113 1e-023
gb|DN447430.1|DN447430 EST943229 Sequencing ESTs from loblo... 113 1e-023
gb|DN447483.1|DN447483 EST943282 Sequencing ESTs from loblo... 113 1e-023
gb|DN449505.1|DN449505 EST945304 Sequencing ESTs from loblo... 113 1e-023
gb|DN453639.1|DN453639 EST949438 Sequencing ESTs from loblo... 113 1e-023
gb|DN454312.1|DN454312 EST950111 Sequencing ESTs from loblo... 113 1e-023
gb|DN455563.1|DN455563 EST951362 Sequencing ESTs from loblo... 113 1e-023
gb|DN457901.1|DN457901 EST953700 Sequencing ESTs from loblo... 113 1e-023
gb|DN459549.1|DN459549 EST955348 Sequencing ESTs from loblo... 113 1e-023
gb|DR014631.1|DR014631 HEAT1_50_D11.g1_A029 Root at 37 C fo... 113 1e-023
gb|DR048524.1|DR048524 RTBOR1_9_A12.g1_A029 Roots plus adde... 113 1e-023
gb|DR162217.1|DR162217 RTFE1_16_A12.g1_A029 Roots minus iro... 113 1e-023
gb|DR181373.1|DR181373 RTMNUT1_38_B07.g2_A029 Roots minus m... 113 1e-023
gb|CF671375.1|CF671375 RTCNT1_56_D12.g1_A029 Root control P... 111 6e-023
gb|DR110306.1|DR110306 RTS1_10_D05.b1_A029 Roots minus sulf... 111 6e-023
gb|DR110394.1|DR110394 RTS1_10_D05.g1_A029 Roots minus sulf... 111 6e-023
gb|BE657088.1|BE657088 NXCI_042_D11_F NXCI (Nsf Xylem Compr... 109 2e-022
gb|BX679239.1|BX679239 BX679239 RS Pinus pinaster cDNA clon... 109 2e-022
gb|BX681413.1|BX681413 BX681413 RS Pinus pinaster cDNA clon... 109 2e-022
gb|BX682186.1|BX682186 BX682186 RS Pinus pinaster cDNA clon... 109 2e-022
gb|CR392122.1|CR392122 CR392122 RN Pinus pinaster cDNA clon... 109 2e-022
gb|CX713747.1|CX713747 RTPQ1_12_D08.g1_A032 Roots treated w... 109 2e-022
gb|DR023572.1|DR023572 STRS1_58_C10.g1_A034 Shoot tip pitch... 109 2e-022
gb|DR117892.1|DR117892 RTMG1_9_H02.g1_A029 Roots minus magn... 109 2e-022
gb|BQ696001.1|BQ696001 NXPV_035_C07_F NXPV (Nsf Xylem Plani... 105 3e-021
gb|BQ696456.1|BQ696456 NXPV_041_E05_F NXPV (Nsf Xylem Plani... 105 3e-021
gb|AA557044.1|AA557044 886 Loblolly pine N Pinus taeda cDNA... 103 1e-020
gb|AW758720.1|AW758720 NXNV_086_F01_F Nsf Xylem Normal wood... 101 5e-020
gb|CF474719.1|CF474719 RTWW2_7_H10.g1_A021 Well-watered lob... 101 5e-020
gb|DR016154.1|DR016154 STRS1_8_C03.b1_A034 Shoot tip pitch ... 101 5e-020
gb|CX649536.1|CX649536 COLD1_35_H06.g1_A029 Root cold Pinus... 100 2e-019
gb|CX649456.1|CX649456 COLD1_35_H06.b1_A029 Root cold Pinus... 96 3e-018
gb|CX650283.1|CX650283 COLD1_44_D12.g1_A029 Root cold Pinus... 96 3e-018
gb|DR178582.1|DR178582 RTMNUT1_12_D12.g1_A029 Roots minus m... 96 3e-018
gb|CO369727.1|CO369727 RTK1_53_D06.b1_A029 Roots minus pota... 94 1e-017
gb|DR080253.1|DR080253 RTFEPL1_21_H11.b1_A029 Roots plus ad... 94 1e-017
gb|CF663603.1|CF663603 RTCNT1_4_B03.b1_A029 Root control Pi... 92 5e-017
gb|DR071054.1|DR071054 RTDK1_17_G08.b1_A029 Roots, dark Pin... 92 5e-017
gb|DR385811.1|DR385811 RTHG1_11_B07.b1_A029 Roots plus adde... 92 5e-017
gb|AW064650.1|AW064650 ST34A10 Pine TriplEx shoot tip libra... 88 8e-016
gb|DR052858.1|DR052858 RTCA1_7_G12.b1_A029 Roots minus calc... 86 3e-015
gb|DR069946.1|DR069946 RTDK1_10_H02.b1_A029 Roots, dark Pin... 86 3e-015
gb|BE656885.1|BE656885 NXCI_057_F08_F NXCI (Nsf Xylem Compr... 84 1e-014
gb|CD017575.1|CD017575 NXCI_128_D09_F NXCI (Nsf Xylem Compr... 84 1e-014
gb|CO361199.1|CO361199 NDL2_3_H08.b1_A029 Needles control 2... 84 1e-014
gb|DR387173.1|DR387173 RTHG1_20_A05.b1_A029 Roots plus adde... 78 8e-013
gb|CV133935.1|CV133935 EST845144 Sequencing ESTs from loblo... 76 3e-012
gb|BE451888.1|BE451888 NXCI_004_G08_F NXCI (Nsf Xylem Compr... 70 2e-010
gb|BE758647.1|BE758647 NXCI_069_E11_F NXCI (Nsf Xylem Compr... 70 2e-010
gb|CF398458.1|CF398458 RTDS3_12_G11.g1_A022 Drought-stresse... 70 2e-010
gb|CO175869.1|CO175869 NDL1_57_D06.g1_A029 Needles control ... 70 2e-010
gb|DR096588.1|DR096588 STRR1_28_H08.g1_A033 Stem Response R... 68 7e-010
gb|DR109792.1|DR109792 RTS1_4_H06.g1_A029 Roots minus sulfu... 64 1e-008
gb|CF386208.1|CF386208 RTDR1_13_D11.b1_A015 Loblolly pine r... 62 5e-008
gb|CF400223.1|CF400223 RTWW1_4_E12.b1_A015 Well-watered lob... 62 5e-008
gb|DR049321.1|DR049321 RTBOR1_15_A11.g1_A029 Roots plus add... 62 5e-008
gb|CV137246.1|CV137246 EST848455 Sequencing ESTs from loblo... 60 2e-007
gb|CF387817.1|CF387817 RTDR1_18_F09.b1_A015 Loblolly pine r... 58 7e-007
gb|DR061161.1|DR061161 RTNIT1_32_A11.g1_A029 Roots minus ni... 58 7e-007
gb|BX249407.1|BX249407 BX249407 Pinus pinaster differenciat... 56 3e-006
gb|BX253888.1|BX253888 BX253888 Pinus pinaster differenciat... 56 3e-006
gb|CF391331.1|CF391331 RTDR3_1_H09.b1_A022 Loblolly pine ro... 56 3e-006
gb|CF400367.1|CF400367 RTWW1_5_F02.b1_A015 Well-watered lob... 56 3e-006
gb|CF666433.1|CF666433 RTCNT1_23_F05.b1_A029 Root control P... 56 3e-006
gb|CF666500.1|CF666500 RTCNT1_23_F05.g1_A029 Root control P... 56 3e-006
gb|CF667058.1|CF667058 RTCNT1_28_A04.b1_A029 Root control P... 56 3e-006
gb|CF671917.1|CF671917 RTCNT1_60_D07.b1_A029 Root control P... 56 3e-006
gb|BX676871.1|BX676871 BX676871 RN Pinus pinaster cDNA clon... 56 3e-006
gb|DN462101.1|DN462101 EST957900 Sequencing ESTs from loblo... 56 3e-006
gb|DR014549.1|DR014549 HEAT1_50_D11.b1_A029 Root at 37 C fo... 56 3e-006
gb|DR023500.1|DR023500 STRS1_58_C10.b1_A034 Shoot tip pitch... 56 3e-006
gb|DR025107.1|DR025107 STRS1_69_D08.g1_A034 Shoot tip pitch... 56 3e-006
gb|DR059696.1|DR059696 RTNIT1_19_E08.b1_A029 Roots minus ni... 56 3e-006
gb|DR116803.1|DR116803 RTMG1_2_H05.g1_A029 Roots minus magn... 56 3e-006
gb|DR162134.1|DR162134 RTFE1_16_A12.b1_A029 Roots minus iro... 56 3e-006
gb|DR178495.1|DR178495 RTMNUT1_12_D12.b1_A029 Roots minus m... 56 3e-006
gb|DR744533.1|DR744533 RTCU1_23_D03.b1_A029 Roots plus adde... 56 3e-006
gb|CD016032.1|CD016032 NXCI_005_A03_F NXCI (Nsf Xylem Compr... 54 1e-005
gb|DN459276.1|DN459276 EST955075 Sequencing ESTs from loblo... 54 1e-005
gb|AA739675.1|AA739675 440 PtIFG2 Pinus taeda cDNA clone 87... 50 2e-004
gb|BF517754.1|BF517754 NXSI_029_H01_F NXSI (Nsf Xylem Side ... 50 2e-004
gb|BG319400.1|BG319400 NXPV_027_E04_F NXPV (Nsf Xylem Plani... 50 2e-004
gb|CF473974.1|CF473974 RTWW2_18_F04.b1_A021 Well-watered lo... 50 2e-004
gb|CF478805.1|CF478805 RTWW3_15_C03.b1_A022 Well-watered lo... 50 2e-004
gb|CF671304.1|CF671304 RTCNT1_56_D12.b1_A029 Root control P... 50 2e-004
gb|DR741994.1|DR741994 RTCU1_1_B12.b1_A029 Roots plus added... 50 2e-004
gb|DR079957.1|DR079957 RTFEPL1_19_B06.b1_A029 Roots plus ad... 46 0.003
>gb|CF387891.1|CF387891 RTDR1_18_F09.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_18_F09_A015 5', mRNA
sequence
Length = 790
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 491 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 432
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 431 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 372
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 371 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 312
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 311 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 252
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 251 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 192
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 191 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 132
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 131 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 72
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 71 accacttgggaaggatcaagcttgggaggcatggctg 35
>gb|CO175804.1|CO175804 NDL1_57_D06.b1_A029 Needles control Pinus taeda cDNA clone
NDL1_57_D06_A029 3', mRNA sequence
Length = 796
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Plus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 255 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 314
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 315 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 374
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 375 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 434
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 435 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 494
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 495 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 554
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 555 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 614
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 615 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 674
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 675 accacttgggaaggatcaagcttgggaggcatggctg 711
>gb|CO367528.1|CO367528 RTK1_34_G11.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_34_G11_A029 5', mRNA sequence
Length = 825
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 536 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 477
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 476 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 417
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 416 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 357
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 356 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 297
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 296 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 237
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 236 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 177
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 176 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 117
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 116 accacttgggaaggatcaagcttgggaggcatggctg 80
>gb|DN460695.1|DN460695 EST956494 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPII149 5' end, mRNA sequence
Length = 733
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 463 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 404
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 403 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 344
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 343 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 284
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 283 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 224
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 223 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 164
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 163 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 104
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 103 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 44
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 43 accacttgggaaggatcaagcttgggaggcatggctg 7
>gb|DN462689.1|DN462689 EST958488 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIIP51 5' end, mRNA sequence
Length = 596
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|DR025028.1|DR025028 STRS1_69_D08.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_69_D08_A034 3', mRNA sequence
Length = 828
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Plus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 283 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 342
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 343 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 402
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 403 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 462
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 463 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 522
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 523 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 582
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 583 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 642
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 643 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 702
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 703 accacttgggaaggatcaagcttgggaggcatggctg 739
>gb|DR093099.1|DR093099 STRR1_6_B07.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_6_B07_A033 3', mRNA sequence
Length = 895
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Plus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 401 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 460
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 461 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 520
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| ||||| ||| || || || |||||||||||||||| |||||| | ||
Sbjct: 521 atgacatcgtctagggcaatatttccattgtgcttgatgttcttcgtcttcttcctatct 580
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 581 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 640
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 641 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 700
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 701 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 760
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 761 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 820
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 821 accacttgggaaggatcaagcttgggaggcatggctg 857
>gb|DR093169.1|DR093169 STRR1_6_B07.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_6_B07_A033 5', mRNA sequence
Length = 834
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Plus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 372 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 431
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 432 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 491
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| ||||| ||| || || || |||||||||||||||| |||||| | ||
Sbjct: 492 atgacatcgtctagggcaatatttccattgtgcttgatgttcttcgtcttcttcctatct 551
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 552 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 611
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 612 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 671
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 672 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 731
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 732 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 791
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 792 accacttgggaaggatcaagcttgggaggcatggctg 828
>gb|DR099634.1|DR099634 STRR1_57_B02.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_57_B02_A033 3', mRNA sequence
Length = 815
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 465 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 406
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 405 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 346
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 345 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 286
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 285 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 226
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 225 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 166
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 165 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 106
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 105 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 46
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 45 accacttgggaaggatcaagcttgggaggcatggctg 9
>gb|DR099694.1|DR099694 STRR1_57_B02.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_57_B02_A033 5', mRNA sequence
Length = 718
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 519 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 460
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 459 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 400
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 399 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 340
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 339 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 280
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 279 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 220
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 219 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 160
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 159 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 100
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 99 accacttgggaaggatcaagcttgggaggcatggctg 63
>gb|DR178936.1|DR178936 RTMNUT1_14_H08.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_14_H08_A029 5', mRNA sequence
Length = 743
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 546 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 487
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 486 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 427
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 426 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 367
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 366 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 307
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 306 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 247
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 246 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 187
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 186 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 127
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 126 accacttgggaaggatcaagcttgggaggcatggctg 90
>gb|DR180061.1|DR180061 RTMNUT1_26_E12.b1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_26_E12_A029 3', mRNA sequence
Length = 887
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 537 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 478
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 477 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 418
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 417 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 358
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 357 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 298
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 297 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 238
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 237 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 178
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 177 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 118
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 117 accacttgggaaggatcaagcttgggaggcatggctg 81
>gb|DR180143.1|DR180143 RTMNUT1_26_E12.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_26_E12_A029 5', mRNA sequence
Length = 776
Score = 129 bits (65), Expect = 2e-028
Identities = 359/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 539 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 480
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 479 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 420
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 419 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 360
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 359 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 300
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 299 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 240
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 239 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 180
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 179 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 120
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 119 accacttgggaaggatcaagcttgggaggcatggctg 83
>gb|CF400481.1|CF400481 RTWW1_5_F02.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_5_F02_A015 5', mRNA sequence
Length = 717
Score = 125 bits (63), Expect = 4e-027
Identities = 294/371 (79%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 433 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 374
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 373 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 314
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 313 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 254
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 253 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 194
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 193 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 134
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 133 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 74
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 73 ttgggggccag 63
>gb|CF671997.1|CF671997 RTCNT1_60_D07.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_60_D07_A029 5', mRNA sequence
Length = 754
Score = 125 bits (63), Expect = 4e-027
Identities = 294/371 (79%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 446 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 387
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 386 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 327
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 326 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 267
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 266 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 207
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 206 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 147
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 146 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 87
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 86 ttgggggccag 76
>gb|DR016208.1|DR016208 STRS1_8_C03.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_8_C03_A034 5', mRNA sequence
Length = 858
Score = 125 bits (63), Expect = 4e-027
Identities = 294/371 (79%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 482 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 423
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 422 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 363
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 362 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 303
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 302 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 243
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 242 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 183
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 182 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 123
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 122 ttgggggccag 112
>gb|DR019892.1|DR019892 STRS1_33_E03.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_33_E03_A034 3', mRNA sequence
Length = 899
Score = 125 bits (63), Expect = 4e-027
Identities = 294/371 (79%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 490 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 431
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 430 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 371
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 370 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 311
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 310 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 251
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 250 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 191
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 190 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 131
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 130 ttgggggccag 120
>gb|DR021389.1|DR021389 STRS1_44_G08.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_44_G08_A034 3', mRNA sequence
Length = 829
Score = 125 bits (63), Expect = 4e-027
Identities = 294/371 (79%)
Strand = Plus / Plus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 431 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 490
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 550
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 551 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 610
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 611 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 670
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 671 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 730
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 731 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 790
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 791 ttgggggccag 801
>gb|DR101560.1|DR101560 STRR1_74_E03.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_74_E03_A033 3', mRNA sequence
Length = 788
Score = 125 bits (63), Expect = 4e-027
Identities = 294/371 (79%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 436 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 377
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 376 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 317
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| ||||| ||| || || || |||||||||||||||| |||||| | ||
Sbjct: 316 atgacatcgtctagggcaatatttccattgtgcttgatgttcttcgtcttcttcctatct 257
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 256 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 197
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 196 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 137
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 136 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 77
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 76 ttgggggccag 66
>gb|DR101629.1|DR101629 STRR1_74_E03.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_74_E03_A033 5', mRNA sequence
Length = 579
Score = 125 bits (63), Expect = 4e-027
Identities = 294/371 (79%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 484 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 425
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 424 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 365
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| ||||| ||| || || || |||||||||||||||| |||||| | ||
Sbjct: 364 atgacatcgtctagggcaatatttccattgtgcttgatgttcttcgtcttcttcctatct 305
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 304 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 245
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 244 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 185
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 184 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 125
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 124 ttgggggccag 114
>gb|DR178852.1|DR178852 RTMNUT1_14_H08.b1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_14_H08_A029 3', mRNA sequence
Length = 772
Score = 125 bits (63), Expect = 4e-027
Identities = 294/371 (79%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 430 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 371
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 370 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 311
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 310 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 251
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 250 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 191
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 190 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 131
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 130 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 71
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 70 ttgggggccag 60
>gb|CF386306.1|CF386306 RTDR1_13_D11.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_13_D11_A015 5', mRNA
sequence
Length = 805
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 531 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 472
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 471 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 412
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 411 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 352
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 351 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 292
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 291 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 232
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 231 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 172
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 171 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 112
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 111 accacttgggaaggatcaagcttgggaggcatggctg 75
>gb|CF400139.1|CF400139 RTWW1_3_H05.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_3_H05_A015 5', mRNA sequence
Length = 727
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 530 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 471
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| | ||||| | | ||||||||
Sbjct: 470 ttcactgatccggccaattccttcgccatggacctcgggctcataaccttagcgatctca 411
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 410 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 351
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 350 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 291
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 290 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 231
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 230 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 171
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 170 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 111
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 110 accacttgggaaggatcaagcttgggaggcatggctg 74
>gb|CF400303.1|CF400303 RTWW1_4_E12.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_4_E12_A015 5', mRNA sequence
Length = 806
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 498 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 439
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 438 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 379
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 378 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 319
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 318 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 259
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 258 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 199
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 198 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 139
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 138 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 79
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 78 accacttgggaaggatcaagcttgggaggcatggctg 42
>gb|CF400876.1|CF400876 RTWW1_8_B05.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_8_B05_A015 5', mRNA sequence
Length = 663
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 525 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 466
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 465 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 406
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 405 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 346
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 345 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 286
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 285 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 226
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 225 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 166
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 165 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 106
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 105 accacttgggaaggatcaagcttgggaggcatggctg 69
>gb|CF663680.1|CF663680 RTCNT1_4_B03.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_4_B03_A029 5', mRNA sequence
Length = 614
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 502 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 443
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 442 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 383
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 382 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 323
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 322 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 263
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 262 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 203
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 202 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 143
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 142 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 83
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 82 accacttgggaaggatcaagcttgggaggcatggctg 46
>gb|CO174224.1|CO174224 NDL1_42_D01.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_42_D01_A029 5', mRNA sequence
Length = 777
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 467 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 408
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 407 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 348
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 347 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 288
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 287 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 228
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 227 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 168
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 167 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 108
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 107 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 48
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 47 accacttgggaaggatcaagcttgggaggcatggctg 11
>gb|CO411231.1|CO411231 EST841616 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIALH50 5' end, mRNA sequence
Length = 826
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || || || || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcttttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|CO413491.1|CO413491 EST843876 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAMB62 5' end, mRNA sequence
Length = 904
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || || || || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcttttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|CV137973.1|CV137973 EST849182 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAX09 5' end, mRNA sequence
Length = 851
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 537 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 478
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 477 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 418
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 417 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 358
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 357 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 298
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 297 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 238
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 237 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 178
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 177 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 118
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 117 accacttgggaaggatcaagcttgggaggcatggctg 81
>gb|CV138881.1|CV138881 EST850090 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIB839 5' end, mRNA sequence
Length = 887
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|CV145594.1|CV145594 EST856803 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIDK46 5' end, mRNA sequence
Length = 767
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 537 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 478
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 477 ttcaccgatccggccaattccttcgccatggacctcggcctcattaccttagcgatctca 418
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 417 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 358
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 357 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 298
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 297 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 238
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 237 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 178
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 177 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 118
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 117 accacttgggaaggatcaagcttgggaggcatggctg 81
>gb|CV147649.1|CV147649 EST858858 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIE953 5' end, mRNA sequence
Length = 418
Score = 121 bits (61), Expect = 6e-026
Identities = 181/221 (81%)
Strand = Plus / Minus
Query: 709 gaccttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtc 768
|||||||||||||| |||||| ||||||||||| || ||||| | | |||||||||||
Sbjct: 299 gaccttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtc 240
Query: 769 cttggccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggcc 828
|||||| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||
Sbjct: 239 cttggcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggacc 180
Query: 829 gatcttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacac 888
||||||||||||||| || || || || || || ||||| || || || | ||| ||||
Sbjct: 179 gatcttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacac 120
Query: 889 ctccaccacctgcgacgggtcgagcttgggcggcatggctg 929
||| ||||| || || || || |||||||| ||||||||||
Sbjct: 119 ctcgaccacttgggaaggatcaagcttgggaggcatggctg 79
>gb|DN446958.1|DN446958 EST942757 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIBN56 5' end, mRNA sequence
Length = 895
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || || || || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcttttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|DN447788.1|DN447788 EST943587 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIBX28 5' end, mRNA sequence
Length = 956
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || || || || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcttttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|DN451081.1|DN451081 EST946880 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIEZ61 5' end, mRNA sequence
Length = 781
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || || || || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcttttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|DN455453.1|DN455453 EST951252 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIGE41 5' end, mRNA sequence
Length = 887
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|DN457081.1|DN457081 EST952880 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIGV96 5' end, mRNA sequence
Length = 838
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 503 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 444
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 443 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 384
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 383 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 324
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 323 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 264
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 263 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 204
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 203 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 144
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 143 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 84
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 83 accacttgggaaggatcaagcttgggaggcatggctg 47
>gb|DN457605.1|DN457605 EST953404 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIH176 5' end, mRNA sequence
Length = 924
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 550 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 491
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 490 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 431
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 430 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 371
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 370 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 311
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 310 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 251
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 250 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 191
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 190 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 131
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 130 accacttgggaaggatcaagcttgggaggcatggctg 94
>gb|DN462207.1|DN462207 EST958006 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIIJ60 5' end, mRNA sequence
Length = 737
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 537 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 478
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 477 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 418
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 417 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 358
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 357 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 298
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 297 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 238
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 237 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 178
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 177 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 118
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 117 accacttgggaaggatcaagcttgggaggcatggctg 81
>gb|DN462754.1|DN462754 EST958553 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIIQ32 5' end, mRNA sequence
Length = 810
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 494 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 435
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 434 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 375
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 374 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 315
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 314 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 255
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 254 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 195
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 194 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 135
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 134 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 75
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 74 accacttgggaaggatcaagcttgggaggcatggctg 38
>gb|DR025491.1|DR025491 STRS1_71_H12.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_71_H12_A034 5', mRNA sequence
Length = 762
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 473 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 414
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 413 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 354
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| || || || |||||||||||||||| |||||| | ||
Sbjct: 353 atgacatcatctagggcaatatttccattgtgcttgatgttcttcgtcttcttcctatct 294
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 293 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 234
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 233 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 174
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 173 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 114
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 113 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 54
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 53 accacttgggaaggatcaagcttgggaggcatggctg 17
>gb|DR071133.1|DR071133 RTDK1_17_G08.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_17_G08_A029 5', mRNA sequence
Length = 590
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 522 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 463
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 462 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 403
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 402 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 343
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 342 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 283
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 282 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 223
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 222 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 163
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 162 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 103
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 102 accacttgggaaggatcaagcttgggaggcatggctg 66
>gb|DR080326.1|DR080326 RTFEPL1_21_H11.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_21_H11_A029 5', mRNA sequence
Length = 780
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 520 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 461
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 460 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 401
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 400 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 341
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 340 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 281
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 280 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 221
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 220 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 161
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 160 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 101
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 100 accacttgggaaggatcaagcttgggaggcatggctg 64
>gb|DR096503.1|DR096503 STRR1_28_H08.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_28_H08_A033 3', mRNA sequence
Length = 793
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Plus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 242 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 301
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 302 ttcactgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 361
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 362 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 421
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 422 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 481
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 482 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 541
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| | ||||| || || ||||||
Sbjct: 542 gcagtttcctttgcaatgtcttctccgatcttcttgggcaatagacccagaggaccgatc 601
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 602 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 661
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 662 accacttgggaaggatcaagcttgggaggcatggctg 698
>gb|DR112603.1|DR112603 RTS1_29_G02.b1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_29_G02_A029 3', mRNA sequence
Length = 789
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Plus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 243 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 302
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 303 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 362
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || ||||||||||||| || |||||| | ||
Sbjct: 363 atgacatcatctagggcgatatttccattgtgcttgatgtttttcgtcttcttcctatct 422
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 423 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 482
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 483 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 542
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 543 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 602
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 603 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 662
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 663 accacttgggaaggatcaagcttgggaggcatggctg 699
>gb|DT624423.1|DT624423 EST1158698 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIMAE45 5' end, mRNA sequence
Length = 917
Score = 121 bits (61), Expect = 6e-026
Identities = 358/457 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 551 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 492
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 491 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 432
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 431 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 372
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 371 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 312
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 311 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 252
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || || || || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 251 gcagtttcttttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 192
Query: 833 ttgggggccagcgaagacgctgcgccgacctcgccgccggtcacacggacgaacacctcc 892
||||||||||| || || || || || || ||||| || || || | ||| |||||||
Sbjct: 191 ttgggggccagagacgaagcagctcccacttcgccccctgtgaccctcacgtacacctcg 132
Query: 893 accacctgcgacgggtcgagcttgggcggcatggctg 929
||||| || || || || |||||||| ||||||||||
Sbjct: 131 accacttgggaaggatcaagcttgggaggcatggctg 95
>gb|BX248907.1|BX248907 BX248907 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP002E09, mRNA sequence
Length = 696
Score = 117 bits (59), Expect = 9e-025
Identities = 293/371 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 505 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 446
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 445 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 386
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| ||||| | ||
Sbjct: 385 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgttttcttcctatct 326
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 325 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 266
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 265 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 206
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 205 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 146
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 145 ttgggggccag 135
>gb|CF667142.1|CF667142 RTCNT1_28_A04.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_28_A04_A029 5', mRNA sequence
Length = 792
Score = 117 bits (59), Expect = 9e-025
Identities = 293/371 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 464 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 405
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 404 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 345
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| |||||| | ||
Sbjct: 344 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgtcttcttcctatct 285
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 284 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 225
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 224 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 165
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || || || || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 164 gcggtttcttttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 105
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 104 ttgggggccag 94
>gb|BX675171.1|BX675171 BX675171 RN Pinus pinaster cDNA clone RN10D08, mRNA sequence
Length = 524
Score = 117 bits (59), Expect = 9e-025
Identities = 293/371 (78%)
Strand = Plus / Minus
Query: 473 tccttggggtccttgccgtcgacggtgcacccgacgctgacgcaggtaccgaggatctcc 532
|||||||| ||||| || || || ||||| |||||| || ||| ||||| || ||||||
Sbjct: 475 tccttgggatcctttccatccaccgtgcagccgacggagaggcatgtacccagaatctcc 416
Query: 533 ttgacggtgccggccaattccttggccatggacctgtgcctcatggtcctggcgatctcg 592
|| || | |||||||||||||| ||||||||||| ||||||| | | ||||||||
Sbjct: 415 ttcaccgatccggccaattccttcgccatggacctcggcctcataaccttagcgatctca 356
Query: 593 atgacgtcgtcgaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtcc 652
||||| || || ||| ||| || || |||||||||||||||| ||||| | ||
Sbjct: 355 atgacatcatctagggcgatatttccattgtgcttgatgttcttcgttttcttcctatct 296
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
||||| |||||||| ||||| || ||||| || || || || || || || | ||||
Sbjct: 295 ctctcgggctccttcagcgcttttatgaccagggcagcagcactcggcaccacagcgacc 236
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|||||||||| |||||| ||||||||||| || ||||| | | ||||||||||||||
Sbjct: 235 ttggcctgcctgttctgaacggtgagctttaccgtgaccctcaaacccttccagtccttc 176
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || ||||| || ||||| ||||||||||||||||| || ||||| || || ||||||
Sbjct: 175 gcagtttcctttgcaatgtcttctccgatcttcttgggcgatagacccagaggaccgatc 116
Query: 833 ttgggggccag 843
|||||||||||
Sbjct: 115 ttgggggccag 105
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 101,621
Number of Sequences: 355925
Number of extensions: 101621
Number of successful extensions: 29060
Number of sequences better than 0.5: 191
Number of HSP's better than 0.5 without gapping: 191
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28277
Number of HSP's gapped (non-prelim): 653
length of query: 985
length of database: 217,277,237
effective HSP length: 19
effective length of query: 966
effective length of database: 210,514,662
effective search space: 203357163492
effective search space used: 203357163492
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)