BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 1804904.2.3
         (801 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CF478995.1|CF478995  RTWW3_21_G12.g1_A022 Well-watered lo...    40   0.14 
gb|DR094994.1|DR094994  STRR1_18_C11.b1_A033 Stem Response R...    40   0.14 
gb|DR682886.1|DR682886  EST1072961 Normalized pine embryo li...    40   0.14 
gb|DT631174.1|DT631174  EST1146105 Normalized pine embryo li...    40   0.14 

>gb|CF478995.1|CF478995 RTWW3_21_G12.g1_A022 Well-watered loblolly pine roots WW3 Pinus
           taeda cDNA clone RTWW3_21_G12_A022 5', mRNA sequence
          Length = 637

 Score = 40.1 bits (20), Expect = 0.14
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 439 caagaggggtggtgctatcaggcaagag 466
           ||||| || |||||||||||||||||||
Sbjct: 46  caagatggatggtgctatcaggcaagag 73



>gb|DR094994.1|DR094994 STRR1_18_C11.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
           STRR1_18_C11_A033 3', mRNA sequence
          Length = 888

 Score = 40.1 bits (20), Expect = 0.14
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 439 caagaggggtggtgctatcaggcaagag 466
           ||||| || |||||||||||||||||||
Sbjct: 666 caagatggatggtgctatcaggcaagag 639



>gb|DR682886.1|DR682886 EST1072961 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAAC87 3' end, mRNA sequence
          Length = 777

 Score = 40.1 bits (20), Expect = 0.14
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 439 caagaggggtggtgctatcaggcaagag 466
           ||||| || |||||||||||||||||||
Sbjct: 103 caagatggatggtgctatcaggcaagag 130



>gb|DT631174.1|DT631174 EST1146105 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMF579 3' end, mRNA sequence
          Length = 868

 Score = 40.1 bits (20), Expect = 0.14
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 439 caagaggggtggtgctatcaggcaagag 466
           ||||| || |||||||||||||||||||
Sbjct: 111 caagatggatggtgctatcaggcaagag 138



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 95,671
Number of Sequences: 355925
Number of extensions: 95671
Number of successful extensions: 25713
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25709
Number of HSP's gapped (non-prelim): 4
length of query: 801
length of database: 217,277,237
effective HSP length: 19
effective length of query: 782
effective length of database: 210,514,662
effective search space: 164622465684
effective search space used: 164622465684
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)