BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 1738955.2.1
         (1271 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CF476071.1|CF476071  RTWW2_16_D03.g1_A021 Well-watered lo...   109   3e-022
gb|CF479898.1|CF479898  RTWW3_12_H04.g1_A022 Well-watered lo...   109   3e-022
gb|CO197872.1|CO197872  GEO1_9_E12.g1_A029 Root gravitropism...   109   3e-022
gb|CX649869.1|CX649869  COLD1_42_B01.b1_A029 Root cold Pinus...   109   3e-022
gb|CX649938.1|CX649938  COLD1_42_B01.g1_A029 Root cold Pinus...   109   3e-022
gb|DR181356.1|DR181356  RTMNUT1_38_A01.g2_A029 Roots minus m...   109   3e-022
gb|DR070227.1|DR070227  RTDK1_12_C03.b1_A029 Roots, dark Pin...   101   7e-020
gb|DR070312.1|DR070312  RTDK1_12_C03.g1_A029 Roots, dark Pin...   101   7e-020
gb|U64890.1|PTU64890  Pinus taeda expansin mRNA, partial cds       92   7e-017
gb|U64891.1|PTU64891  Pinus taeda expansin mRNA, partial cds       92   7e-017
gb|U64893.1|PTU64893  Pinus taeda expansin mRNA, partial cds       92   7e-017
gb|AF085330.1|AF085330  Pinus taeda expansin mRNA, complete cds    92   7e-017
gb|U64892.1|PTU64892  Pinus taeda expansin mRNA, partial cds       92   7e-017
gb|DR097316.1|DR097316  STRR1_33_H05.g3_A033 Stem Response R...    88   1e-015
gb|DR011201.1|DR011201  HEAT1_4_E06.b1_A029 Root at 37 C for...    78   1e-012
gb|DR047687.1|DR047687  RTBOR1_2_F07.g1_A029 Roots plus adde...    78   1e-012
gb|DR180723.1|DR180723  RTMNUT1_34_A06.g1_A029 Roots minus m...    78   1e-012
gb|CF477384.1|CF477384  RTWW3_7_A01.g1_A022 Well-watered lob...    74   2e-011
gb|CO367410.1|CO367410  RTK1_34_D03.b1_A029 Roots minus pota...    74   2e-011
gb|CO367487.1|CO367487  RTK1_34_D03.g1_A029 Roots minus pota...    74   2e-011
gb|CO369598.1|CO369598  RTK1_48_F01.b1_A029 Roots minus pota...    74   2e-011
gb|CO369680.1|CO369680  RTK1_48_F01.g1_A029 Roots minus pota...    74   2e-011
gb|CX648930.1|CX648930  COLD1_31_H02.g1_A029 Root cold Pinus...    74   2e-011
gb|DR050231.1|DR050231  RTBOR1_22_D04.b1_A029 Roots plus add...    74   2e-011
gb|DR050310.1|DR050310  RTBOR1_22_D04.g1_A029 Roots plus add...    74   2e-011
gb|DR051834.1|DR051834  RTBOR1_32_E10.g1_A029 Roots plus add...    74   2e-011
gb|DR093671.1|DR093671  STRR1_9_E07.g1_A033 Stem Response Re...    74   2e-011
gb|DR165660.1|DR165660  RTPHOS1_6_B10.g1_A029 Roots minus ph...    74   2e-011
gb|DR168497.1|DR168497  RTPHOS1_25_G11.g1_A029 Roots minus p...    74   2e-011
gb|DR683982.1|DR683982  EST1074058 Normalized pine embryo li...    74   2e-011
gb|DT631935.1|DT631935  EST1146866 Normalized pine embryo li...    74   2e-011
gb|DT632413.1|DT632413  EST1147344 Normalized pine embryo li...    74   2e-011
gb|DR010784.1|DR010784  HEAT1_1_F12.b1_A029 Root at 37 C for...    70   2e-010
gb|DR010861.1|DR010861  HEAT1_1_F12.g1_A029 Root at 37 C for...    70   2e-010
gb|DR120161.1|DR120161  RTMG1_27_H07.g2_A029 Roots minus mag...    68   1e-009
gb|DR120696.1|DR120696  RTMG1_31_G12.b1_A029 Roots minus mag...    68   1e-009
gb|CV144435.1|CV144435  EST855644 Sequencing ESTs from loblo...    66   4e-009
gb|DT624714.1|DT624714  EST1159049 Sequencing ESTs from lobl...    66   4e-009
gb|CF399941.1|CF399941  RTWW1_2_C11.b1_A015 Well-watered lob...    64   2e-008
gb|CX650634.1|CX650634  COLD1_47_B12.b1_A029 Root cold Pinus...    64   2e-008
gb|CX650703.1|CX650703  COLD1_47_B12.g1_A029 Root cold Pinus...    64   2e-008
gb|DR019211.1|DR019211  STRS1_28_B06.g1_A034 Shoot tip pitch...    64   2e-008
gb|CF471900.1|CF471900  RTDS1_7_A08.b1_A015 Drought-stressed...    62   6e-008
gb|CF471926.1|CF471926  RTDS1_7_A08.g1_A015 Drought-stressed...    62   6e-008
gb|CF668214.1|CF668214  RTCNT1_35_D04.b1_A029 Root control P...    62   6e-008
gb|CF668294.1|CF668294  RTCNT1_35_D04.g1_A029 Root control P...    62   6e-008
gb|DR051762.1|DR051762  RTBOR1_32_E10.b1_A029 Roots plus add...    62   6e-008
gb|DR096360.1|DR096360  STRR1_27_B05.g1_A033 Stem Response R...    62   6e-008
gb|DR119250.1|DR119250  RTMG1_22_C11.b1_A029 Roots minus mag...    62   6e-008
gb|DR119331.1|DR119331  RTMG1_22_C11.g1_A029 Roots minus mag...    62   6e-008
gb|DT624311.1|DT624311  EST1158586 Sequencing ESTs from lobl...    62   6e-008
gb|CO368672.1|CO368672  RTK1_42_C07.b1_A029 Roots minus pota...    60   2e-007
gb|CO368748.1|CO368748  RTK1_42_C07.g1_A029 Roots minus pota...    60   2e-007
gb|CV035793.1|CV035793  RTNACL1_42_B01.g1_A029 Roots plus ad...    60   2e-007
gb|DR071171.1|DR071171  RTDK1_18_C12.b1_A029 Roots, dark Pin...    60   2e-007
gb|BG039378.1|BG039378  NXSI_098_D11_F NXSI (Nsf Xylem Side ...    58   9e-007
gb|CF391855.1|CF391855  RTDR3_10_C05.g1_A022 Loblolly pine r...    58   9e-007
gb|CF400653.1|CF400653  RTWW1_6_A01.g1_A015 Well-watered lob...    58   9e-007
gb|CF475910.1|CF475910  RTWW2_15_D07.g1_A021 Well-watered lo...    58   9e-007
gb|CF663902.1|CF663902  RTCNT1_5_H12.g1_A029 Root control Pi...    58   9e-007
gb|CN784348.1|CN784348  EST783039 Sequencing ESTs from loblo...    58   9e-007
gb|CO172418.1|CO172418  NDL1_29_D02.g1_A029 Needles control ...    58   9e-007
gb|CX650764.1|CX650764  COLD1_48_A05.b1_A029 Root cold Pinus...    58   9e-007
gb|DR688987.1|DR688987  EST1079073 Normalized pine embryo li...    58   9e-007
gb|DR692635.1|DR692635  EST1082723 Normalized pine embryo li...    58   9e-007
gb|DT625757.1|DT625757  EST1157681 Sequencing ESTs from lobl...    58   9e-007
gb|AW290421.1|AW290421  NXNV020D02F Nsf Xylem Normal wood Ve...    56   4e-006
gb|BQ198383.1|BQ198383  NXLV130_C02_F NXLV (Nsf Xylem Late w...    56   4e-006
gb|CD027081.1|CD027081  NXNV020D02 Nsf Xylem Normal wood Ver...    56   4e-006
gb|DR055360.1|DR055360  RTCA1_23_E11.b1_A029 Roots minus cal...    56   4e-006
gb|DR055518.1|DR055518  RTCA1_24_E10.b1_A029 Roots minus cal...    56   4e-006
gb|DR684423.1|DR684423  EST1074500 Normalized pine embryo li...    56   4e-006
gb|DR692432.1|DR692432  EST1082520 Normalized pine embryo li...    56   4e-006
gb|CF666895.1|CF666895  RTCNT1_26_G11.g1_A029 Root control P...    54   1e-005
gb|CO171305.1|CO171305  NDL1_20_C09.g1_A029 Needles control ...    54   1e-005
gb|DR021085.1|DR021085  STRS1_42_F09.b1_A034 Shoot tip pitch...    54   1e-005
gb|DR021165.1|DR021165  STRS1_42_F09.g1_A034 Shoot tip pitch...    54   1e-005
gb|DR095411.1|DR095411  STRR1_20_G09.g1_A033 Stem Response R...    54   1e-005
gb|DR685073.1|DR685073  EST1075150 Normalized pine embryo li...    54   1e-005
gb|CF400025.1|CF400025  RTWW1_2_C11.g1_A015 Well-watered lob...    52   6e-005
gb|CO361349.1|CO361349  NDL2_4_G08.b1_A029 Needles control 2...    52   6e-005
gb|CO361435.1|CO361435  NDL2_4_G08.g1_A029 Needles control 2...    52   6e-005
gb|CX648594.1|CX648594  COLD1_29_D11.g1_A029 Root cold Pinus...    52   6e-005
gb|DR163147.1|DR163147  RTFE1_41_E12.b1_A029 Roots minus iro...    52   6e-005
gb|DR163235.1|DR163235  RTFE1_41_E12.g1_A029 Roots minus iro...    52   6e-005
gb|DR163481.1|DR163481  RTFE1_43_D12.b1_A029 Roots minus iro...    52   6e-005
gb|DR163657.1|DR163657  RTFE1_44_D12.b1_A029 Roots minus iro...    52   6e-005
gb|DR163745.1|DR163745  RTFE1_44_D12.g1_A029 Roots minus iro...    52   6e-005
gb|DR694543.1|DR694543  EST1084635 Normalized pine embryo li...    52   6e-005
gb|DR742067.1|DR742067  RTCU1_1_B09.g1_A029 Roots plus added...    52   6e-005
gb|DR745029.1|DR745029  RTCU1_26_C03.g1_A029 Roots plus adde...    52   6e-005
gb|DT639052.1|DT639052  EST1153983 Normalized pine embryo li...    52   6e-005
gb|BX251144.1|BX251144  BX251144 Pinus pinaster differenciat...    50   2e-004
gb|BX251561.1|BX251561  BX251561 Pinus pinaster differenciat...    50   2e-004
gb|BX251613.1|BX251613  BX251613 Pinus pinaster differenciat...    50   2e-004
gb|BX253271.1|BX253271  BX253271 Pinus pinaster differenciat...    50   2e-004
gb|BX254474.1|BX254474  BX254474 Pinus pinaster differenciat...    50   2e-004
gb|BE762031.1|BE762031  NXCI_076_B10_F NXCI (Nsf Xylem Compr...    50   2e-004
gb|CF386013.1|CF386013  RTDR1_7_F11.g1_A015 Loblolly pine ro...    50   2e-004
gb|CF391890.1|CF391890  RTDR3_10_G01.g1_A022 Loblolly pine r...    50   2e-004
gb|CF479851.1|CF479851  RTWW3_12_D07.g1_A022 Well-watered lo...    50   2e-004
gb|CF668487.1|CF668487  RTCNT1_36_F12.g1_A029 Root control P...    50   2e-004
gb|BX682844.1|BX682844  BX682844 Pinus pinaster differenciat...    50   2e-004
gb|CR393207.1|CR393207  CR393207 RN Pinus pinaster cDNA clon...    50   2e-004
gb|CR393417.1|CR393417  CR393417 RN Pinus pinaster cDNA clon...    50   2e-004
gb|CO166169.1|CO166169  FLD1_59_G05.g1_A029 Root flooded Pin...    50   2e-004
gb|CO169428.1|CO169428  NDL1_7_B04.b1_A029 Needles control P...    50   2e-004
gb|CO169500.1|CO169500  NDL1_7_B04.g1_A029 Needles control P...    50   2e-004
gb|CO200976.1|CO200976  RTCNT2_2_G03.g1_A029 Root control 2 ...    50   2e-004
gb|CO362158.1|CO362158  RTK1_1_E05.g1_A029 Roots minus potas...    50   2e-004
gb|CO362167.1|CO362167  RTK1_1_F05.g1_A029 Roots minus potas...    50   2e-004
gb|DR015281.1|DR015281  STRS1_2_C05.g1_A034 Shoot tip pitch ...    50   2e-004
gb|DR022663.1|DR022663  STRS1_52_D06.g1_A034 Shoot tip pitch...    50   2e-004
gb|DR023285.1|DR023285  STRS1_56_D02.g1_A034 Shoot tip pitch...    50   2e-004
gb|DR024833.1|DR024833  STRS1_67_F03.g1_A034 Shoot tip pitch...    50   2e-004
gb|DR051531.1|DR051531  RTBOR1_30_E09.g1_A029 Roots plus add...    50   2e-004
gb|DR070152.1|DR070152  RTDK1_11_D01.g1_A029 Roots, dark Pin...    50   2e-004
gb|DR070635.1|DR070635  RTDK1_14_D09.g1_A029 Roots, dark Pin...    50   2e-004
gb|DR080162.1|DR080162  RTFEPL1_20_E11.g1_A029 Roots plus ad...    50   2e-004
gb|DR093057.1|DR093057  STRR1_5_F06.g1_A033 Stem Response Re...    50   2e-004
gb|DR096273.1|DR096273  STRR1_26_H05.g1_A033 Stem Response R...    50   2e-004
gb|DR096352.1|DR096352  STRR1_27_A07.g1_A033 Stem Response R...    50   2e-004
gb|DR099166.1|DR099166  STRR1_53_C12.g1_A033 Stem Response R...    50   2e-004
gb|DR100480.1|DR100480  STRR1_64_A12.g1_A033 Stem Response R...    50   2e-004
gb|DR120128.1|DR120128  RTMG1_27_E05.g2_A029 Roots minus mag...    50   2e-004
gb|DR687528.1|DR687528  EST1077610 Normalized pine embryo li...    50   2e-004
gb|DR692513.1|DR692513  EST1082601 Normalized pine embryo li...    50   2e-004
gb|DR746394.1|DR746394  RTCU1_36_E04.g1_A029 Roots plus adde...    50   2e-004
gb|DT633920.1|DT633920  EST1148851 Normalized pine embryo li...    50   2e-004
gb|DT637181.1|DT637181  EST1152112 Normalized pine embryo li...    50   2e-004
gb|AA556812.1|AA556812  654 Loblolly pine C Pinus taeda cDNA...    48   9e-004
gb|AA556861.1|AA556861  703 Loblolly pine C Pinus taeda cDNA...    48   9e-004
gb|AW011524.1|AW011524  ST21H02 Pine TriplEx shoot tip libra...    48   9e-004
gb|BF049828.1|BF049828  NXCI_111_D09_F NXCI (Nsf Xylem Compr...    48   9e-004
gb|BF609532.1|BF609532  NXSI_043_G01_F NXSI (Nsf Xylem Side ...    48   9e-004
gb|BF778581.1|BF778581  NXSI_088_D02_F NXSI (Nsf Xylem Side ...    48   9e-004
gb|CX646780.1|CX646780  COLD1_11_B06.g1_A029 Root cold Pinus...    48   9e-004
gb|CX649475.1|CX649475  COLD1_35_B04.g1_A029 Root cold Pinus...    48   9e-004
gb|CX652556.1|CX652556  COLD1_59_H02.g1_A029 Root cold Pinus...    48   9e-004
gb|CX713463.1|CX713463  RTPQ1_9_C04.g1_A032 Roots treated wi...    48   9e-004
gb|DR011619.1|DR011619  HEAT1_6_G09.g1_A029 Root at 37 C for...    48   9e-004
gb|DR055148.1|DR055148  RTCA1_21_G09.g2_A029 Roots minus cal...    48   9e-004
gb|DR056610.1|DR056610  RTCA1_31_A02.g1_A029 Roots minus cal...    48   9e-004
gb|DR070179.1|DR070179  RTDK1_11_F07.g1_A029 Roots, dark Pin...    48   9e-004
gb|DR072178.1|DR072178  RTDK1_24_C09.g1_A029 Roots, dark Pin...    48   9e-004
gb|DR089298.1|DR089298  RTAL1_7_G03.g1_A029 Roots plus added...    48   9e-004
gb|DR090373.1|DR090373  RTAL1_14_D02.g1_A029 Roots plus adde...    48   9e-004
gb|DR090533.1|DR090533  RTAL1_15_E12.g1_A029 Roots plus adde...    48   9e-004
gb|DR092307.1|DR092307  RTAL1_28_G05.b1_A029 Roots plus adde...    48   9e-004
gb|DR098553.1|DR098553  STRR1_46_F12.b1_A033 Stem Response R...    48   9e-004
gb|DR100599.1|DR100599  STRR1_65_E02.g1_A033 Stem Response R...    48   9e-004
gb|DR102236.1|DR102236  STRR1_79_C04.g1_A033 Stem Response R...    48   9e-004
gb|DR113034.1|DR113034  RTS1_32_B12.g1_A029 Roots minus sulf...    48   9e-004
gb|DR163422.1|DR163422  RTFE1_42_G07.g1_A029 Roots minus iro...    48   9e-004
gb|DT636492.1|DT636492  EST1151423 Normalized pine embryo li...    48   9e-004
gb|CF386766.1|CF386766  RTDR1_16_C08.g1_A015 Loblolly pine r...    46   0.004
gb|CF400637.1|CF400637  RTWW1_6_B06.g1_A015 Well-watered lob...    46   0.004
gb|CF478581.1|CF478581  RTWW3_16_B04.b1_A022 Well-watered lo...    46   0.004
gb|DR055601.1|DR055601  RTCA1_24_E10.g2_A029 Roots minus cal...    46   0.004
gb|DR168662.1|DR168662  RTPHOS1_27_B09.b1_A029 Roots minus p...    46   0.004
gb|CF402042.1|CF402042  RTWW1_16_F09.g1_A015 Well-watered lo...    42   0.055
gb|BF609490.1|BF609490  NXSI_043_C03_F NXSI (Nsf Xylem Side ...    40   0.22 
gb|DT632636.1|DT632636  EST1147567 Normalized pine embryo li...    40   0.22 
>gb|CF476071.1|CF476071 RTWW2_16_D03.g1_A021 Well-watered loblolly pine roots WW2 Pinus
           taeda cDNA clone RTWW2_16_D03_A021 5', mRNA sequence
          Length = 725

 Score =  109 bits (55), Expect = 3e-022
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
           |||||||||| |||||||| |||||| |||||||| |||| ||||     ||||||||||
Sbjct: 510 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 451

                                                                       
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
           || ||||||||||||||||||||||| || |||||||| || || |||||||| ||||| 
Sbjct: 450 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 391

                                                                       
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
           || |  || |||||||| || ||| | ||||| || |  || ||||| |||||||| |||
Sbjct: 390 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 331

                              
Query: 703 tggccgttgatggtgaacc 721
           || ||||| | ||||||||
Sbjct: 330 tgcccgttcacggtgaacc 312
>gb|CF479898.1|CF479898 RTWW3_12_H04.g1_A022 Well-watered loblolly pine roots WW3 Pinus
           taeda cDNA clone RTWW3_12_H04_A022 5', mRNA sequence
          Length = 734

 Score =  109 bits (55), Expect = 3e-022
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
           |||||||||| |||||||| |||||| |||||||| |||| ||||     ||||||||||
Sbjct: 477 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 418

                                                                       
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
           || ||||||||||||||||||||||| || |||||||| || || |||||||| ||||| 
Sbjct: 417 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 358

                                                                       
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
           || |  || |||||||| || ||| | ||||| || |  || ||||| |||||||| |||
Sbjct: 357 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 298

                              
Query: 703 tggccgttgatggtgaacc 721
           || ||||| | ||||||||
Sbjct: 297 tgcccgttcacggtgaacc 279
>gb|CO197872.1|CO197872 GEO1_9_E12.g1_A029 Root gravitropism April 2003 test Pinus taeda
           cDNA clone GEO1_9_E12_A029 5', mRNA sequence
          Length = 812

 Score =  109 bits (55), Expect = 3e-022
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
           |||||||||| |||||||| |||||| |||||||| |||| ||||     ||||||||||
Sbjct: 760 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 701

                                                                       
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
           || ||||||||||||||||||||||| || |||||||| || || |||||||| ||||| 
Sbjct: 700 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 641

                                                                       
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
           || |  || |||||||| || ||| | ||||| || |  || ||||| |||||||| |||
Sbjct: 640 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 581

                              
Query: 703 tggccgttgatggtgaacc 721
           || ||||| | ||||||||
Sbjct: 580 tgcccgttcacggtgaacc 562
>gb|CX649869.1|CX649869 COLD1_42_B01.b1_A029 Root cold Pinus taeda cDNA clone
           COLD1_42_B01_A029 3', mRNA sequence
          Length = 792

 Score =  109 bits (55), Expect = 3e-022
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
           |||||||||| |||||||| |||||| |||||||| |||| ||||     ||||||||||
Sbjct: 220 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 161

                                                                       
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
           || ||||||||||||||||||||||| || |||||||| || || |||||||| ||||| 
Sbjct: 160 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 101

                                                                       
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
           || |  || |||||||| || ||| | ||||| || |  || ||||| |||||||| |||
Sbjct: 100 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 41

                              
Query: 703 tggccgttgatggtgaacc 721
           || ||||| | ||||||||
Sbjct: 40  tgcccgttcacggtgaacc 22
>gb|CX649938.1|CX649938 COLD1_42_B01.g1_A029 Root cold Pinus taeda cDNA clone
           COLD1_42_B01_A029 5', mRNA sequence
          Length = 862

 Score =  109 bits (55), Expect = 3e-022
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
           |||||||||| |||||||| |||||| |||||||| |||| ||||     ||||||||||
Sbjct: 743 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 684

                                                                       
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
           || ||||||||||||||||||||||| || |||||||| || || |||||||| ||||| 
Sbjct: 683 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 624

                                                                       
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
           || |  || |||||||| || ||| | ||||| || |  || ||||| |||||||| |||
Sbjct: 623 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 564

                              
Query: 703 tggccgttgatggtgaacc 721
           || ||||| | ||||||||
Sbjct: 563 tgcccgttcacggtgaacc 545
>gb|DR181356.1|DR181356 RTMNUT1_38_A01.g2_A029 Roots minus micronutrients Pinus taeda cDNA
           clone RTMNUT1_38_A01_A029 5', mRNA sequence
          Length = 765

 Score =  109 bits (55), Expect = 3e-022
 Identities = 163/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
           |||||||||| |||||||| |||||| |||||||| |||| ||||     ||||||||||
Sbjct: 719 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 660

                                                                       
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
           || ||||||||||||||||||||||| || |||||||| || || |||||||| ||||| 
Sbjct: 659 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 600

                                                                       
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
           || |  || |||||||| || ||| | ||||| || |  || ||||| |||||||| |||
Sbjct: 599 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 540

                              
Query: 703 tggccgttgatggtgaacc 721
           || ||||| | ||||||||
Sbjct: 539 tgcccgttcacggtgaacc 521
>gb|DR070227.1|DR070227 RTDK1_12_C03.b1_A029 Roots, dark Pinus taeda cDNA clone
           RTDK1_12_C03_A029 3', mRNA sequence
          Length = 725

 Score =  101 bits (51), Expect = 7e-020
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
           |||||||||| |||||||| |||||| |||||||| |||| ||||     ||||||||||
Sbjct: 176 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 117

                                                                      
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatgga 641
           || ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 116 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatgga 58
>gb|DR070312.1|DR070312 RTDK1_12_C03.g1_A029 Roots, dark Pinus taeda cDNA clone
           RTDK1_12_C03_A029 5', mRNA sequence
          Length = 710

 Score =  101 bits (51), Expect = 7e-020
 Identities = 162/199 (81%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
           |||||||||| |||||| | |||||| |||||||| |||| ||||     ||||||||||
Sbjct: 682 ccgtcgctggtggtgactttgaaggagaggctctgcccgttgaggtaactgttgctctgc 623

                                                                       
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
           || ||||||||||||||||||||||| || |||||||| || || |||||||| ||||| 
Sbjct: 622 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 563

                                                                       
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
           || |  || |||||||| || ||| | ||||| || |  || ||||| |||||||| |||
Sbjct: 562 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 503

                              
Query: 703 tggccgttgatggtgaacc 721
           || ||||| | ||||||||
Sbjct: 502 tgcccgttcacggtgaacc 484
>gb|U64890.1|PTU64890 Pinus taeda expansin mRNA, partial cds
          Length = 923

 Score = 91.7 bits (46), Expect = 7e-017
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
           ||||| |||||||  ||||||||||| || |||||||| |||| ||||  ||| ||||| 
Sbjct: 627 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtacgaattgctt 568

                                                 
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
           ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 567 tgccagttctgtccccagttgcgtgacatgggctgcca 530

 Score = 52.0 bits (26), Expect = 6e-005
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 833 gcggcgggttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagt 892
           |||| ||||||||||| || |||| |||| |||| ||  ||| ||| |||||||||||||
Sbjct: 314 gcggtgggttgcaccatccaccgttgtcgttgggaagagcgttgttcggcgggcagaagt 255

                     
Query: 893 tggtggccgt 902
           |||| |||||
Sbjct: 254 tggtagccgt 245
>gb|U64891.1|PTU64891 Pinus taeda expansin mRNA, partial cds
          Length = 919

 Score = 91.7 bits (46), Expect = 7e-017
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
           ||||| |||||||  ||||||||||| || |||||||| |||| ||||  ||| ||||| 
Sbjct: 627 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtacgaattgctt 568

                                                 
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
           ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 567 tgccagttctgtccccagttgcgtgacatgggctgcca 530

 Score = 60.0 bits (30), Expect = 2e-007
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 833 gcggcgggttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagt 892
           |||| ||||||||||| || |||| |||| |||||||  ||| ||| |||||||||||||
Sbjct: 314 gcggtgggttgcaccatccaccgttgtcgttggggagagcgttgtttggcgggcagaagt 255

                     
Query: 893 tggtggccgt 902
           |||| |||||
Sbjct: 254 tggtagccgt 245
>gb|U64893.1|PTU64893 Pinus taeda expansin mRNA, partial cds
          Length = 891

 Score = 91.7 bits (46), Expect = 7e-017
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
           ||||| |||||||  ||||||||||| || |||||||| |||| ||||   |||||||| 
Sbjct: 627 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtaggagttgctt 568

                                                 
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
           ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 567 tgccagttctgtccccagttgcgtgacatgggctgcca 530

 Score = 65.9 bits (33), Expect = 4e-009
 Identities = 174/221 (78%)
 Strand = Plus / Minus

                                                                       
Query: 682 agcaccaggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacg 741
           ||||||||||||||||| |||||||| || | |||||| |  || || |||||| ||| |
Sbjct: 465 agcaccaggttgaagtatgagtggccattcacggtgaaacgaattccacccttcctcaag 406

                                                                       
Query: 742 cacggcaccctcctgtaggcgacgggcacgatgccggcgcggtactgcgcgatctggagg 801
           || || |||||  |||||  || ||| ||||| ||  | | ||||| ||||||||  || 
Sbjct: 405 caggggacccttgtgtagaggatggggacgatcccacccctgtacttcgcgatcttcaga 346

                                                                       
Query: 802 aaggccggctgggccatgtcgaagtgcgggcgcggcgggttgcaccagccgccgtcgtcg 861
           || || ||||  ||||| ||||| ||| |  |||| ||||||||||| || |||| ||||
Sbjct: 345 aaagcgggctccgccatatcgaaatgctgcagcggtgggttgcaccatccaccgttgtcg 286

                                                    
Query: 862 ctggggaggccgtagttgggcgggcagaagttggtggccgt 902
            |||||||  ||| ||| ||||||||||||||||| |||||
Sbjct: 285 ttggggagagcgttgtttggcgggcagaagttggtagccgt 245
>gb|AF085330.1|AF085330 Pinus taeda expansin mRNA, complete cds
          Length = 998

 Score = 91.7 bits (46), Expect = 7e-017
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
           ||||| |||||||  ||||||||||| || |||||||| |||| ||||  ||| ||||| 
Sbjct: 778 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtacgaattgctt 719

                                                 
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
           ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 718 tgccagttctgtccccagttgcgtgacatgggctgcca 681

 Score = 52.0 bits (26), Expect = 6e-005
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 833 gcggcgggttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagt 892
           |||| ||||||||||| || |||| |||| |||||||  ||| ||| || ||||||||||
Sbjct: 465 gcggtgggttgcaccatccaccgttgtcgttggggagagcgttgtttggtgggcagaagt 406

                     
Query: 893 tggtggccgt 902
           |||| |||||
Sbjct: 405 tggtagccgt 396
>gb|U64892.1|PTU64892 Pinus taeda expansin mRNA, partial cds
          Length = 923

 Score = 91.7 bits (46), Expect = 7e-017
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
           ||||| |||||||  ||||||||||| || |||||||| |||| ||||  ||| ||||| 
Sbjct: 627 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtacgaattgctt 568

                                                 
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
           ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 567 tgccagttctgtccccagttgcgtgacatgggctgcca 530

 Score = 60.0 bits (30), Expect = 2e-007
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 833 gcggcgggttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagt 892
           |||| ||||||||||| || |||| |||| |||||||  ||| ||| |||||||||||||
Sbjct: 314 gcggtgggttgcaccatccaccgttgtcgttggggagagcgttgtttggcgggcagaagt 255

                     
Query: 893 tggtggccgt 902
           |||| |||||
Sbjct: 254 tggtagccgt 245
>gb|DR097316.1|DR097316 STRR1_33_H05.g3_A033 Stem Response Resistant Pinus taeda cDNA clone
           STRR1_33_H05_A033 5', mRNA sequence
          Length = 794

 Score = 87.7 bits (44), Expect = 1e-015
 Identities = 83/96 (86%)
 Strand = Plus / Plus

                                                                       
Query: 522 gccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctg 581
           ||||||||||| |||||| |||||||| |||||||| ||||  |||   |||||||| ||
Sbjct: 225 gccgtcgctggtggtgacttggaaggataggctctgtccgttcaggtaagagttgctttg 284

                                               
Query: 582 ccagttctggccccagttgcgggacatgggctgcca 617
           ||||||||| ||||||||||| ||||||| ||||||
Sbjct: 285 ccagttctgtccccagttgcgtgacatggcctgcca 320

 Score = 46.1 bits (23), Expect = 0.004
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 841 ttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagttggtggc 899
           |||||||| ||||||| |||| |||| ||  | | ||| ||||||||||||||||||||
Sbjct: 544 ttgcaccacccgccgttgtcgttgggaagagcattgtttggcgggcagaagttggtggc 602
>gb|DR011201.1|DR011201 HEAT1_4_E06.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
           HEAT1_4_E06_A029 3', mRNA sequence
          Length = 752

 Score = 77.8 bits (39), Expect = 1e-012
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  |  |  || ||||| |||||||||
Sbjct: 339 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 280

                                              
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
           || ||||||||||| |||||||||||||| |||||
Sbjct: 279 tgtccccagttgcgtgacatgggctgccaaccggt 245

 Score = 42.1 bits (21), Expect = 0.055
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 688 aggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacgcacggc 747
           ||||||||||| |||||||||  ||| ||||| |  || ||||||||| ||| |||||| 
Sbjct: 180 aggttgaagtatgagtggccggcgatagtgaagcgaattccgcccttcctcaagcacggg 121

                
Query: 748 accct 752
           |||||
Sbjct: 120 accct 116
>gb|DR047687.1|DR047687 RTBOR1_2_F07.g1_A029 Roots plus added boron Pinus taeda cDNA clone
           RTBOR1_2_F07_A029 5', mRNA sequence
          Length = 689

 Score = 77.8 bits (39), Expect = 1e-012
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  |  |  || ||||| |||||||||
Sbjct: 218 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 159

                                              
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
           || ||||||||||| |||||||||||||| |||||
Sbjct: 158 tgtccccagttgcgtgacatgggctgccaaccggt 124
>gb|DR180723.1|DR180723 RTMNUT1_34_A06.g1_A029 Roots minus micronutrients Pinus taeda cDNA
           clone RTMNUT1_34_A06_A029 5', mRNA sequence
          Length = 773

 Score = 77.8 bits (39), Expect = 1e-012
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  |  |  || ||||| |||||||||
Sbjct: 685 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 626

                                              
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
           || ||||||||||| |||||||||||||| |||||
Sbjct: 625 tgtccccagttgcgtgacatgggctgccaaccggt 591
>gb|CF477384.1|CF477384 RTWW3_7_A01.g1_A022 Well-watered loblolly pine roots WW3 Pinus
           taeda cDNA clone RTWW3_7_A01_A022 5', mRNA sequence
          Length = 715

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 690 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 631

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 630 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 571

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 570 ttgaagtaggagtgcccattgatcgtgaa 542
>gb|CO367410.1|CO367410 RTK1_34_D03.b1_A029 Roots minus potassium Pinus taeda cDNA clone
           RTK1_34_D03_A029 3', mRNA sequence
          Length = 851

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 504 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 445

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 444 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 385

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 384 ttgaagtaggagtgcccattgatcgtgaa 356
>gb|CO367487.1|CO367487 RTK1_34_D03.g1_A029 Roots minus potassium Pinus taeda cDNA clone
           RTK1_34_D03_A029 5', mRNA sequence
          Length = 788

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 695 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 636

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 635 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 576

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 575 ttgaagtaggagtgcccattgatcgtgaa 547
>gb|CO369598.1|CO369598 RTK1_48_F01.b1_A029 Roots minus potassium Pinus taeda cDNA clone
           RTK1_48_F01_A029 3', mRNA sequence
          Length = 820

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  | ||| || ||| |||| 
Sbjct: 329 gagttgctctgccaattctgtccccagttgcgggacattgcttcccaaccagtgttggaa 388

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||||||||| |||||  | |||||||| |  |||||||  
Sbjct: 389 cctttgatggaaacagcctccacgtcccctgcgcctcctacgttggtaatgagcaccaaa 448

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           ||||| |||||||| || ||||| |||||
Sbjct: 449 ttgaaataggagtgcccattgattgtgaa 477
>gb|CO369680.1|CO369680 RTK1_48_F01.g1_A029 Roots minus potassium Pinus taeda cDNA clone
           RTK1_48_F01_A029 5', mRNA sequence
          Length = 697

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  | ||| || ||| |||| 
Sbjct: 543 gagttgctctgccaattctgtccccagttgcgggacattgcttcccaaccagtgttggaa 602

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||||||||| |||||  | |||||||| |  |||||||  
Sbjct: 603 cctttgatggaaacagcctccacgtcccctgcgcctcctacgttggtaatgagcaccaaa 662

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           ||||| |||||||| || ||||| |||||
Sbjct: 663 ttgaaataggagtgcccattgattgtgaa 691
>gb|CX648930.1|CX648930 COLD1_31_H02.g1_A029 Root cold Pinus taeda cDNA clone
           COLD1_31_H02_A029 5', mRNA sequence
          Length = 857

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 719 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 660

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 659 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 600

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 599 ttgaagtaggagtgcccattgatcgtgaa 571
>gb|DR050231.1|DR050231 RTBOR1_22_D04.b1_A029 Roots plus added boron Pinus taeda cDNA clone
           RTBOR1_22_D04_A029 3', mRNA sequence
          Length = 692

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 227 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 168

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 167 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 108

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 107 ttgaagtaggagtgcccattgatcgtgaa 79
>gb|DR050310.1|DR050310 RTBOR1_22_D04.g1_A029 Roots plus added boron Pinus taeda cDNA clone
           RTBOR1_22_D04_A029 5', mRNA sequence
          Length = 806

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 717 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 658

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 657 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 598

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 597 ttgaagtaggagtgcccattgatcgtgaa 569
>gb|DR051834.1|DR051834 RTBOR1_32_E10.g1_A029 Roots plus added boron Pinus taeda cDNA clone
           RTBOR1_32_E10_A029 5', mRNA sequence
          Length = 796

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 736 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 677

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 676 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 617

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 616 ttgaagtaggagtgcccattgatcgtgaa 588
>gb|DR093671.1|DR093671 STRR1_9_E07.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
           STRR1_9_E07_A033 5', mRNA sequence
          Length = 789

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 705 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 646

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 645 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 586

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 585 ttgaagtaggagtgcccattgatcgtgaa 557
>gb|DR165660.1|DR165660 RTPHOS1_6_B10.g1_A029 Roots minus phosphorous Pinus taeda cDNA
           clone RTPHOS1_6_B10_A029 5', mRNA sequence
          Length = 779

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 359 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 418

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 419 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 478

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 479 ttgaagtaggagtgcccattgatcgtgaa 507
>gb|DR168497.1|DR168497 RTPHOS1_25_G11.g1_A029 Roots minus phosphorous Pinus taeda cDNA
           clone RTPHOS1_25_G11_A029 5', mRNA sequence
          Length = 702

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 694 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 635

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  
Sbjct: 634 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 575

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 574 ttgaagtaggagtgcccattgatcgtgaa 546
>gb|DR683982.1|DR683982 EST1074058 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAAN59 3' end, mRNA sequence
          Length = 876

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  | ||  || ||||| |||||||||
Sbjct: 495 ctggtggtgaccttgaaggacaggctctgcccgttcaagaaggaattgctttgccagttc 436

                                        
Query: 589 tggccccagttgcgggacatgggctgcca 617
           || ||||||||||| ||||| ||||||||
Sbjct: 435 tgtccccagttgcgtgacatcggctgcca 407

 Score = 42.1 bits (21), Expect = 0.055
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 841 ttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagttggtggcc 900
           |||||||| || |||| || | |||| ||| ||| |||||| |||||||||||||| || 
Sbjct: 183 ttgcaccatccaccgttgttgttgggaagggcgttgttgggtgggcagaagttggtcgct 124

                
Query: 901 gtgac 905
           |||||
Sbjct: 123 gtgac 119
>gb|DT631935.1|DT631935 EST1146866 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMFE52 3' end, mRNA sequence
          Length = 858

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  | ||  || ||||| |||||||||
Sbjct: 503 ctggtggtgaccttgaaggacaggctctgcccgttcaagaaggaattgctttgccagttc 444

                                        
Query: 589 tggccccagttgcgggacatgggctgcca 617
           || ||||||||||| ||||| ||||||||
Sbjct: 443 tgtccccagttgcgtgacatcggctgcca 415

 Score = 42.1 bits (21), Expect = 0.055
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 841 ttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagttggtggcc 900
           |||||||| || |||| || | |||| ||| ||| |||||| |||||||||||||| || 
Sbjct: 191 ttgcaccatccaccgttgttgttgggaagggcgttgttgggtgggcagaagttggtcgct 132

                
Query: 901 gtgac 905
           |||||
Sbjct: 131 gtgac 127
>gb|DT632413.1|DT632413 EST1147344 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMFJ73 3' end, mRNA sequence
          Length = 826

 Score = 73.8 bits (37), Expect = 2e-011
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  | ||  || ||||| |||||||||
Sbjct: 763 ctggtggtgaccttgaaggacaggctctgcccgttcaagaaggaattgctttgccagttc 704

                                        
Query: 589 tggccccagttgcgggacatgggctgcca 617
           || ||||||||||| ||||| ||||||||
Sbjct: 703 tgtccccagttgcgtgacatcggctgcca 675

 Score = 42.1 bits (21), Expect = 0.055
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 841 ttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagttggtggcc 900
           |||||||| || |||| || | |||| ||| ||| |||||| |||||||||||||| || 
Sbjct: 451 ttgcaccatccaccgttgttgttgggaagggcgttgttgggtgggcagaagttggtcgct 392

                
Query: 901 gtgac 905
           |||||
Sbjct: 391 gtgac 387
>gb|DR010784.1|DR010784 HEAT1_1_F12.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
           HEAT1_1_F12_A029 3', mRNA sequence
          Length = 680

 Score = 69.9 bits (35), Expect = 2e-010
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  |  |  || ||||| |||||||||
Sbjct: 274 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 215

                                              
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
           || ||||||||||| ||||| |||||||| |||||
Sbjct: 214 tgtccccagttgcgtgacataggctgccaaccggt 180
>gb|DR010861.1|DR010861 HEAT1_1_F12.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
           HEAT1_1_F12_A029 5', mRNA sequence
          Length = 733

 Score = 69.9 bits (35), Expect = 2e-010
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  |  |  || ||||| |||||||||
Sbjct: 675 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 616

                                              
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
           || ||||||||||| ||||| |||||||| |||||
Sbjct: 615 tgtccccagttgcgtgacataggctgccaaccggt 581
>gb|DR120161.1|DR120161 RTMG1_27_H07.g2_A029 Roots minus magnesium Pinus taeda cDNA clone
           RTMG1_27_H07_A029 5', mRNA sequence
          Length = 693

 Score = 67.9 bits (34), Expect = 1e-009
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgccacccggt 623
           ||||| ||||||||||| ||||||||||| |||||||||||||| |||||
Sbjct: 663 ttgctttgccagttctgtccccagttgcgtgacatgggctgccaaccggt 614
>gb|DR120696.1|DR120696 RTMG1_31_G12.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
           RTMG1_31_G12_A029 3', mRNA sequence
          Length = 865

 Score = 67.9 bits (34), Expect = 1e-009
 Identities = 118/146 (80%)
 Strand = Plus / Plus

                                                                       
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggagccc 633
           ||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| || 
Sbjct: 144 ttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaacct 203

                                                                       
Query: 634 ttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttg 693
           |||||||| || | || ||| || || |||||  | |||||||| |  |||||||  |||
Sbjct: 204 ttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaattg 263

                                     
Query: 694 aagtaggagtggccgttgatggtgaa 719
           ||||||||||| || ||||| |||||
Sbjct: 264 aagtaggagtgcccattgatcgtgaa 289
>gb|CV144435.1|CV144435 EST855644 Sequencing ESTs from loblolly pine embryos Pinus taeda
           cDNA clone RPID557 5' end, mRNA sequence
          Length = 769

 Score = 65.9 bits (33), Expect = 4e-009
 Identities = 120/149 (80%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 678 gagttgctctgccaattctgtccccagttgcgggacattgcttgccaaccagtgttggat 619

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  || ||||  
Sbjct: 618 cctttgatggaaaccgcctccacatcgcctgcgcctcctacgttggtaatgagtaccaaa 559

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 558 ttgaagtaggagtgcccattgatcgtgaa 530
>gb|DT624714.1|DT624714 EST1159049 Sequencing ESTs from loblolly pine embryos Pinus taeda
           cDNA clone PIMAI31 5' end, mRNA sequence
          Length = 844

 Score = 65.9 bits (33), Expect = 4e-009
 Identities = 120/149 (80%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 678 gagttgctctgccaattctgtccccagttgcgggacattgcttgccaaccagtgttggat 619

                                                                       
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
           || |||||||| || | || ||| || || |||||  | |||||||| |  || ||||  
Sbjct: 618 cctttgatggaaaccgcctccacatcgcctgcgcctcctacgttggtaatgagtaccaaa 559

                                        
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
           |||||||||||||| || ||||| |||||
Sbjct: 558 ttgaagtaggagtgcccattgatcgtgaa 530
>gb|CF399941.1|CF399941 RTWW1_2_C11.b1_A015 Well-watered loblolly pine roots WW1 Pinus
           taeda cDNA clone RTWW1_2_C11_A015 3', mRNA sequence
          Length = 668

 Score = 63.9 bits (32), Expect = 2e-008
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgcca 617
           ||||| ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 274 ttgctttgccagttctgtccccagttgcgtgacatgggctgcca 231

 Score = 46.1 bits (23), Expect = 0.004
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 682 agcaccaggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacg 741
           ||||||||||||||||| |||||||| || | |||||| |  || || |||||| |||||
Sbjct: 166 agcaccaggttgaagtatgagtggccattcacggtgaaacgaattcctcccttcctcacg 107

                      
Query: 742 cacggcaccct 752
           || || |||||
Sbjct: 106 caggggaccct 96
>gb|CX650634.1|CX650634 COLD1_47_B12.b1_A029 Root cold Pinus taeda cDNA clone
           COLD1_47_B12_A029 3', mRNA sequence
          Length = 711

 Score = 63.9 bits (32), Expect = 2e-008
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgcca 617
           ||||| ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 220 ttgctttgccagttctgtccccagttgcgtgacatgggctgcca 177

 Score = 52.0 bits (26), Expect = 6e-005
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 682 agcaccaggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacg 741
           ||||||||||||||||| |||||||| || | |||||| |  || || |||||| |||||
Sbjct: 112 agcaccaggttgaagtatgagtggccattcacggtgaaacgaattcctcccttcctcacg 53

                             
Query: 742 cacggcaccctcctgtag 759
           || || ||||| ||||||
Sbjct: 52  caggggacccttctgtag 35
>gb|CX650703.1|CX650703 COLD1_47_B12.g1_A029 Root cold Pinus taeda cDNA clone
           COLD1_47_B12_A029 5', mRNA sequence
          Length = 629

 Score = 63.9 bits (32), Expect = 2e-008
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgcca 617
           ||||| ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 502 ttgctttgccagttctgtccccagttgcgtgacatgggctgcca 459

 Score = 58.0 bits (29), Expect = 9e-007
 Identities = 173/221 (78%)
 Strand = Plus / Minus

                                                                       
Query: 682 agcaccaggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacg 741
           ||||||||||||||||| |||||||| || | |||||| |  || || |||||| |||||
Sbjct: 394 agcaccaggttgaagtatgagtggccattcacggtgaaacgaattcctcccttcctcacg 335

                                                                       
Query: 742 cacggcaccctcctgtaggcgacgggcacgatgccggcgcggtactgcgcgatctggagg 801
           || || ||||| ||||||  ||  || ||||| ||  |   ||||| |||||||||  | 
Sbjct: 334 caggggacccttctgtagaggatagggacgatcccccccttgtacttcgcgatctgctga 275

                                                                       
Query: 802 aaggccggctgggccatgtcgaagtgcgggcgcggcgggttgcaccagccgccgtcgtcg 861
           || || ||||  ||||| ||||| ||| |  |||| ||||||||||| || |||| ||||
Sbjct: 274 aaagcgggctccgccatatcgaaatgctgcagcggtgggttgcaccatccaccgttgtcg 215

                                                    
Query: 862 ctggggaggccgtagttgggcgggcagaagttggtggccgt 902
            |||||||  ||| ||| |||||||||||||| || |||||
Sbjct: 214 ttggggagagcgttgtttggcgggcagaagttagtagccgt 174
>gb|DR019211.1|DR019211 STRS1_28_B06.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
           cDNA clone STRS1_28_B06_A034 5', mRNA sequence
          Length = 869

 Score = 63.9 bits (32), Expect = 2e-008
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 526 tcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccag 585
           ||||||| |||||||| |||||| ||||||||||| | ||||   |||||||| ||||| 
Sbjct: 731 tcgctggtggtgaccttgaaggagaggctctggccattgaggtaggagttgctttgccaa 672

                                           
Query: 586 ttctggccccagttgcgggacatgggctgcca 617
           || || ||||||||||| ||||| || |||||
Sbjct: 671 ttttgtccccagttgcgtgacattggttgcca 640
>gb|CF471900.1|CF471900 RTDS1_7_A08.b1_A015 Drought-stressed loblolly pine roots DS1 Pinus
           taeda cDNA clone RTDS1_7_A08_A015 3', mRNA sequence
          Length = 661

 Score = 61.9 bits (31), Expect = 6e-008
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| |||| 
Sbjct: 250 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 191

                      
Query: 631 cccttgatgga 641
           || ||||||||
Sbjct: 190 cctttgatgga 180
>gb|CF471926.1|CF471926 RTDS1_7_A08.g1_A015 Drought-stressed loblolly pine roots DS1 Pinus
           taeda cDNA clone RTDS1_7_A08_A015 5', mRNA sequence
          Length = 751

 Score = 61.9 bits (31), Expect = 6e-008
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| |||| 
Sbjct: 595 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 536

                      
Query: 631 cccttgatgga 641
           || ||||||||
Sbjct: 535 cctttgatgga 525
>gb|CF668214.1|CF668214 RTCNT1_35_D04.b1_A029 Root control Pinus taeda cDNA clone
           RTCNT1_35_D04_A029 3', mRNA sequence
          Length = 592

 Score = 61.9 bits (31), Expect = 6e-008
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| |||| 
Sbjct: 243 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 184

                      
Query: 631 cccttgatgga 641
           || ||||||||
Sbjct: 183 cctttgatgga 173
>gb|CF668294.1|CF668294 RTCNT1_35_D04.g1_A029 Root control Pinus taeda cDNA clone
           RTCNT1_35_D04_A029 5', mRNA sequence
          Length = 751

 Score = 61.9 bits (31), Expect = 6e-008
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| |||| 
Sbjct: 548 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 489

                      
Query: 631 cccttgatgga 641
           || ||||||||
Sbjct: 488 cctttgatgga 478
>gb|DR051762.1|DR051762 RTBOR1_32_E10.b1_A029 Roots plus added boron Pinus taeda cDNA clone
           RTBOR1_32_E10_A029 3', mRNA sequence
          Length = 574

 Score = 61.9 bits (31), Expect = 6e-008
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||||||||| |  ||||| || ||| |||| 
Sbjct: 124 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 65

                      
Query: 631 cccttgatgga 641
           || ||||||||
Sbjct: 64  cctttgatgga 54
>gb|DR096360.1|DR096360 STRR1_27_B05.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
           STRR1_27_B05_A033 5', mRNA sequence
          Length = 780

 Score = 61.9 bits (31), Expect = 6e-008
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
           |||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| |||| 
Sbjct: 484 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 425

                      
Query: 631 cccttgatgga 641
           || ||||||||
Sbjct: 424 cctttgatgga 414
>gb|DR119250.1|DR119250 RTMG1_22_C11.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
           RTMG1_22_C11_A029 3', mRNA sequence
          Length = 773

 Score = 61.9 bits (31), Expect = 6e-008
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  |  |  || || || |||||||||
Sbjct: 406 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattactttgccagttc 465

                                              
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
           || ||||||||||| ||||| |||||||| |||||
Sbjct: 466 tgtccccagttgcgtgacataggctgccaaccggt 500
>gb|DR119331.1|DR119331 RTMG1_22_C11.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
           RTMG1_22_C11_A029 5', mRNA sequence
          Length = 753

 Score = 61.9 bits (31), Expect = 6e-008
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
           |||| |||||||| ||||||||||||||| ||||  |  |  || || || |||||||||
Sbjct: 387 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattactttgccagttc 446

                                              
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
           || ||||||||||| ||||| |||||||| |||||
Sbjct: 447 tgtccccagttgcgtgacataggctgccaaccggt 481
  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 135,428
Number of Sequences: 355925
Number of extensions: 135428
Number of successful extensions: 36587
Number of sequences better than  0.5: 164
Number of HSP's better than  0.5 without gapping: 155
Number of HSP's successfully gapped in prelim test: 9
Number of HSP's that attempted gapping in prelim test: 36021
Number of HSP's gapped (non-prelim): 514
length of query: 1271
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1252
effective length of database: 210,514,662
effective search space: 263564356824
effective search space used: 263564356824
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)