BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1716394.2.1
(1074 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DR387538.1|DR387538 RTHG1_22_B10.g2_A029 Roots plus adde... 48 8e-004
gb|AW981543.1|AW981543 PC13H03 Pine TriplEx pollen cone lib... 40 0.18
gb|BM492242.1|BM492242 NXRV_022_F03_F NXRV (Nsf Xylem Root ... 40 0.18
gb|DR119749.1|DR119749 RTMG1_25_F09.b1_A029 Roots minus mag... 40 0.18
gb|U02533.1|PSU02533 Pinus strobus chlorophyll biosynthetic... 40 0.18
dbj|D11467.1|PINCHD Pinus thunbergii chloroplast genes for ... 40 0.18
dbj|D17510.1|PINCPTRPG Pinus thunbergii chloroplast DNA, co... 40 0.18
gb|AY228468.1| Pinus Koraiensis chloroplast, complete genome 40 0.18
ref|NC_001631.1| Pinus thunbergii chloroplast, complete genome 40 0.18
ref|NC_004677.1| Pinus koraiensis chloroplast, complete genome 40 0.18
>gb|DR387538.1|DR387538 RTHG1_22_B10.g2_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_22_B10_A029 5', mRNA sequence
Length = 592
Score = 48.1 bits (24), Expect = 8e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 581 agcctacgtgcagcggctggtggacgtcgccgacgaagtg 620
|||| ||||| || |||||||||||||| |||||||||||
Sbjct: 432 agccaacgtggaggggctggtggacgtcaccgacgaagtg 393
>gb|AW981543.1|AW981543 PC13H03 Pine TriplEx pollen cone library Pinus taeda cDNA clone
PC13H03, mRNA sequence
Length = 595
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 267 aaaataatcatctcctagag 286
||||||||||||||||||||
Sbjct: 48 aaaataatcatctcctagag 67
>gb|BM492242.1|BM492242 NXRV_022_F03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_022_F03 5', mRNA sequence
Length = 675
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 267 aaaataatcatctcctagag 286
||||||||||||||||||||
Sbjct: 410 aaaataatcatctcctagag 391
>gb|DR119749.1|DR119749 RTMG1_25_F09.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_25_F09_A029 3', mRNA sequence
Length = 636
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 990 gaggaggaggaggaagacga 1009
||||||||||||||||||||
Sbjct: 477 gaggaggaggaggaagacga 496
>gb|U02533.1|PSU02533 Pinus strobus chlorophyll biosynthetic enzyme subunit (chlB) gene,
chloroplast gene encoding chloroplast protein, partial
cds
Length = 1533
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 267 aaaataatcatctcctagag 286
||||||||||||||||||||
Sbjct: 117 aaaataatcatctcctagag 98
>dbj|D11467.1|PINCHD Pinus thunbergii chloroplast genes for tRNA-Gln, tRNA-Lys,
tRNA-Ile, tRNA-His and photosystem II D1 protein,
complete cds
Length = 7440
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 267 aaaataatcatctcctagag 286
||||||||||||||||||||
Sbjct: 392 aaaataatcatctcctagag 373
>dbj|D17510.1|PINCPTRPG Pinus thunbergii chloroplast DNA, complete sequence
Length = 119707
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 267 aaaataatcatctcctagag 286
||||||||||||||||||||
Sbjct: 6283 aaaataatcatctcctagag 6302
>gb|AY228468.1| Pinus Koraiensis chloroplast, complete genome
Length = 116866
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 267 aaaataatcatctcctagag 286
||||||||||||||||||||
Sbjct: 6076 aaaataatcatctcctagag 6095
>ref|NC_001631.1| Pinus thunbergii chloroplast, complete genome
Length = 119707
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 267 aaaataatcatctcctagag 286
||||||||||||||||||||
Sbjct: 6283 aaaataatcatctcctagag 6302
>ref|NC_004677.1| Pinus koraiensis chloroplast, complete genome
Length = 116866
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 267 aaaataatcatctcctagag 286
||||||||||||||||||||
Sbjct: 6076 aaaataatcatctcctagag 6095
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 144,562
Number of Sequences: 355925
Number of extensions: 144562
Number of successful extensions: 44343
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44292
Number of HSP's gapped (non-prelim): 51
length of query: 1074
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1055
effective length of database: 210,514,662
effective search space: 222092968410
effective search space used: 222092968410
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)