BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131543.2.1
(634 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AA739750.1|AA739750 515 PtIFG2 Pinus taeda cDNA clone 88... 50 1e-004
gb|AW064862.1|AW064862 ST36G02 Pine TriplEx shoot tip libra... 50 1e-004
gb|AL750057.1|AL750057 AL750057 AS Pinus pinaster cDNA clon... 50 1e-004
gb|AL750066.1|AL750066 AL750066 AS Pinus pinaster cDNA clon... 50 1e-004
gb|AL750433.1|AL750433 AL750433 RN Pinus pinaster cDNA clon... 50 1e-004
gb|BX250562.1|BX250562 BX250562 Pinus pinaster differenciat... 50 1e-004
gb|BX253067.1|BX253067 BX253067 Pinus pinaster differenciat... 50 1e-004
gb|BX253197.1|BX253197 BX253197 Pinus pinaster differenciat... 50 1e-004
gb|BX253596.1|BX253596 BX253596 Pinus pinaster differenciat... 50 1e-004
gb|BX254128.1|BX254128 BX254128 Pinus pinaster differenciat... 50 1e-004
gb|BX254430.1|BX254430 BX254430 Pinus pinaster differenciat... 50 1e-004
gb|BX255376.1|BX255376 BX255376 Pinus pinaster differenciat... 50 1e-004
gb|BE496472.1|BE496472 NXCI_018_E06_F NXCI (Nsf Xylem Compr... 50 1e-004
gb|BF220655.1|BF220655 NXCI_151_B08_F NXCI (Nsf Xylem Compr... 50 1e-004
gb|BF777488.1|BF777488 NXSI_069_B08_F NXSI (Nsf Xylem Side ... 50 1e-004
gb|BG040067.1|BG040067 NXSI_106_A02_F NXSI (Nsf Xylem Side ... 50 1e-004
gb|BG275893.1|BG275893 NXSI_149_B12_F NXSI (Nsf Xylem Side ... 50 1e-004
gb|BM427978.1|BM427978 NXRV_007_B01_F NXRV (Nsf Xylem Root ... 50 1e-004
gb|BM427981.1|BM427981 NXRV_007_B07_F NXRV (Nsf Xylem Root ... 50 1e-004
gb|BM492562.1|BM492562 NXRV_028_B03_F NXRV (Nsf Xylem Root ... 50 1e-004
gb|BQ701602.1|BQ701602 NXSI_111_E05_F NXSI (Nsf Xylem Side ... 50 1e-004
gb|CD017537.1|CD017537 NXCI_124_H03_F NXCI (Nsf Xylem Compr... 50 1e-004
gb|BX681303.1|BX681303 BX681303 RS Pinus pinaster cDNA clon... 50 1e-004
gb|BX681367.1|BX681367 BX681367 RS Pinus pinaster cDNA clon... 50 1e-004
gb|BX682309.2|BX682309 BX682309 Pinus pinaster differenciat... 50 1e-004
gb|CR392485.1|CR392485 CR392485 RN Pinus pinaster cDNA clon... 50 1e-004
gb|DN627075.1|DN627075 EST977891 Subtracted pine embryo lib... 50 1e-004
gb|DN627179.1|DN627179 EST977995 Subtracted pine embryo lib... 50 1e-004
gb|DN632513.1|DN632513 EST983329 Subtracted pine embryo lib... 50 1e-004
gb|DN633693.1|DN633693 EST984509 Subtracted pine embryo lib... 50 1e-004
gb|DN633772.1|DN633772 EST984588 Subtracted pine embryo lib... 50 1e-004
gb|DN633894.1|DN633894 EST984710 Subtracted pine embryo lib... 50 1e-004
gb|DN634507.1|DN634507 EST985323 Subtracted pine embryo lib... 50 1e-004
gb|DR686678.1|DR686678 EST1076756 Normalized pine embryo li... 50 1e-004
gb|CO163966.1|CO163966 FLD1_45_A08.b1_A029 Root flooded Pin... 46 0.002
gb|DR025637.1|DR025637 STRS1_72_G09.g1_A034 Shoot tip pitch... 46 0.002
gb|BE662593.1|BE662593 ST88/ST88D04 Pine TriplEx shoot tip ... 44 0.007
gb|CO368579.1|CO368579 RTK1_41_B07.g1_A029 Roots minus pota... 44 0.007
gb|DR011795.1|DR011795 HEAT1_8_A08.b1_A029 Root at 37 C for... 44 0.007
gb|DR743615.1|DR743615 RTCU1_17_B12.b1_A029 Roots plus adde... 44 0.007
gb|BM493575.1|BM493575 NXLV_066_F12_F NXLV (Nsf Xylem Late ... 42 0.027
gb|BM493839.1|BM493839 NXLV_070_C06_F NXLV (Nsf Xylem Late ... 42 0.027
gb|BQ197167.1|BQ197167 NXLV110_C11_F NXLV (Nsf Xylem Late w... 42 0.027
gb|CF668206.1|CF668206 RTCNT1_35_C05.b1_A029 Root control P... 42 0.027
gb|CO159352.1|CO159352 FLD1_13_C07.b1_A029 Root flooded Pin... 42 0.027
gb|CO162755.1|CO162755 FLD1_37_G05.b1_A029 Root flooded Pin... 42 0.027
gb|CO162838.1|CO162838 FLD1_37_G05.g1_A029 Root flooded Pin... 42 0.027
gb|CO167884.1|CO167884 FLD1_71_H01.g1_A029 Root flooded Pin... 42 0.027
gb|CX645736.1|CX645736 COLD1_5_B06.b1_A029 Root cold Pinus ... 42 0.027
gb|CX649263.1|CX649263 COLD1_34_C09.b1_A029 Root cold Pinus... 42 0.027
gb|CX649581.1|CX649581 COLD1_36_E01.b1_A029 Root cold Pinus... 42 0.027
gb|CX653077.1|CX653077 COLD1_63_F09.b1_A029 Root cold Pinus... 42 0.027
gb|CX714541.1|CX714541 RTPQ1_23_G07.b1_A032 Roots treated w... 42 0.027
gb|DR011200.1|DR011200 HEAT1_4_E05.b1_A029 Root at 37 C for... 42 0.027
gb|DR055573.1|DR055573 RTCA1_24_C05.g2_A029 Roots minus cal... 42 0.027
gb|DR078362.1|DR078362 RTFEPL1_3_D11.g1_A029 Roots plus add... 42 0.027
gb|DR165917.1|DR165917 RTPHOS1_8_D05.b1_A029 Roots minus ph... 42 0.027
gb|DR742146.1|DR742146 RTCU1_2_B11.b1_A029 Roots plus added... 42 0.027
gb|DR743224.1|DR743224 RTCU1_14_H09.b1_A029 Roots plus adde... 42 0.027
gb|DR743296.1|DR743296 RTCU1_14_H09.g1_A029 Roots plus adde... 42 0.027
gb|DR743354.1|DR743354 RTCU1_15_F10.b1_A029 Roots plus adde... 42 0.027
gb|DR743503.1|DR743503 RTCU1_16_G03.b1_A029 Roots plus adde... 42 0.027
gb|BX254682.1|BX254682 BX254682 Pinus pinaster differenciat... 40 0.11
gb|CO157679.1|CO157679 FLD1_1_G07.b1_A029 Root flooded Pinu... 40 0.11
gb|CO159073.1|CO159073 FLD1_11_D12.b1_A029 Root flooded Pin... 40 0.11
gb|CO159516.1|CO159516 FLD1_14_C07.b1_A029 Root flooded Pin... 40 0.11
gb|CO160691.1|CO160691 FLD1_23_G09.b1_A029 Root flooded Pin... 40 0.11
gb|CO161605.1|CO161605 FLD1_30_B01.b1_A029 Root flooded Pin... 40 0.11
gb|CO163120.1|CO163120 FLD1_39_C07.g1_A029 Root flooded Pin... 40 0.11
gb|CO164354.1|CO164354 FLD1_47_B03.g1_A029 Root flooded Pin... 40 0.11
gb|CO164472.1|CO164472 FLD1_48_F03.b1_A029 Root flooded Pin... 40 0.11
gb|CO164798.1|CO164798 FLD1_50_H09.b1_A029 Root flooded Pin... 40 0.11
gb|CO166017.1|CO166017 FLD1_58_E10.g1_A029 Root flooded Pin... 40 0.11
gb|CO167042.1|CO167042 FLD1_66_H11.b1_A029 Root flooded Pin... 40 0.11
gb|CO167112.1|CO167112 FLD1_66_H11.g1_A029 Root flooded Pin... 40 0.11
gb|CO167254.1|CO167254 FLD1_67_G09.g1_A029 Root flooded Pin... 40 0.11
gb|CO167457.1|CO167457 FLD1_69_C03.b1_A029 Root flooded Pin... 40 0.11
gb|CO167472.1|CO167472 FLD1_69_D10.b1_A029 Root flooded Pin... 40 0.11
gb|CO361147.1|CO361147 NDL2_3_C03.b1_A029 Needles control 2... 40 0.11
gb|CO365341.1|CO365341 RTK1_25_C11.b1_A029 Roots minus pota... 40 0.11
gb|CV032910.1|CV032910 RTNACL1_19_C02.b1_A029 Roots plus ad... 40 0.11
gb|CV034123.1|CV034123 RTNACL1_38_G06.g1_A029 Roots plus ad... 40 0.11
gb|CV034300.1|CV034300 RTNACL1_40_B04.b1_A029 Roots plus ad... 40 0.11
gb|CV035968.1|CV035968 RTNACL1_43_E11.g1_A029 Roots plus ad... 40 0.11
gb|CV036028.1|CV036028 RTNACL1_44_D08.b1_A029 Roots plus ad... 40 0.11
gb|CV036346.1|CV036346 RTNACL1_58_C12.g1_A029 Roots plus ad... 40 0.11
gb|CV036406.1|CV036406 RTNACL1_59_C03.b1_A029 Roots plus ad... 40 0.11
gb|CX646168.1|CX646168 COLD1_7_E11.g1_A029 Root cold Pinus ... 40 0.11
gb|CX646247.1|CX646247 COLD1_8_E09.b1_A029 Root cold Pinus ... 40 0.11
gb|CX646668.1|CX646668 COLD1_10_F09.g1_A029 Root cold Pinus... 40 0.11
gb|CX647297.1|CX647297 COLD1_15_D02.b1_A029 Root cold Pinus... 40 0.11
gb|CX647304.1|CX647304 COLD1_15_D12.b1_A029 Root cold Pinus... 40 0.11
gb|CX647312.1|CX647312 COLD1_15_E09.b1_A029 Root cold Pinus... 40 0.11
gb|CX648663.1|CX648663 COLD1_30_D01.b1_A029 Root cold Pinus... 40 0.11
gb|CX648994.1|CX648994 COLD1_32_F06.b1_A029 Root cold Pinus... 40 0.11
gb|CX649893.1|CX649893 COLD1_42_D08.b1_A029 Root cold Pinus... 40 0.11
gb|CX649963.1|CX649963 COLD1_42_D08.g1_A029 Root cold Pinus... 40 0.11
gb|CX651426.1|CX651426 COLD1_52_G06.b1_A029 Root cold Pinus... 40 0.11
gb|CX652147.1|CX652147 COLD1_57_E12.b1_A029 Root cold Pinus... 40 0.11
gb|CX652758.1|CX652758 COLD1_61_F10.b1_A029 Root cold Pinus... 40 0.11
gb|CX653047.1|CX653047 COLD1_63_C08.b1_A029 Root cold Pinus... 40 0.11
gb|CX653068.1|CX653068 COLD1_63_E09.b1_A029 Root cold Pinus... 40 0.11
gb|CX653070.1|CX653070 COLD1_63_E11.b1_A029 Root cold Pinus... 40 0.11
gb|DN612455.1|DN612455 EST965505 Subtracted pine embryo lib... 40 0.11
gb|DR011079.1|DR011079 HEAT1_3_F10.b1_A029 Root at 37 C for... 40 0.11
gb|DR013868.1|DR013868 HEAT1_22_B11.b1_A029 Root at 37 C fo... 40 0.11
gb|DR022191.1|DR022191 STRS1_49_A10.g1_A034 Shoot tip pitch... 40 0.11
gb|DR048162.1|DR048162 RTBOR1_7_B01.b2_A029 Roots plus adde... 40 0.11
gb|DR048460.1|DR048460 RTBOR1_9_C07.b1_A029 Roots plus adde... 40 0.11
gb|DR049686.1|DR049686 RTBOR1_18_H10.b1_A029 Roots plus add... 40 0.11
gb|DR050726.1|DR050726 RTBOR1_25_G05.b1_A029 Roots plus add... 40 0.11
gb|DR071785.1|DR071785 RTDK1_22_C07.b1_A029 Roots, dark Pin... 40 0.11
gb|DR091230.1|DR091230 RTAL1_20_E11.b1_A029 Roots plus adde... 40 0.11
gb|DR092301.1|DR092301 RTAL1_28_F11.b1_A029 Roots plus adde... 40 0.11
gb|DR110190.1|DR110190 RTS1_9_A09.g1_A029 Roots minus sulfu... 40 0.11
gb|DR110622.1|DR110622 RTS1_12_A05.b1_A029 Roots minus sulf... 40 0.11
gb|DR167155.1|DR167155 RTPHOS1_17_C03.b1_A029 Roots minus p... 40 0.11
gb|DR167782.1|DR167782 RTPHOS1_21_B06.b1_A029 Roots minus p... 40 0.11
gb|DR168998.1|DR168998 RTPHOS1_29_G02.b1_A029 Roots minus p... 40 0.11
gb|DR385118.1|DR385118 RTHG1_6_F02.g1_A029 Roots plus added... 40 0.11
gb|DR385475.1|DR385475 RTHG1_8_H03.g1_A029 Roots plus added... 40 0.11
gb|DR387956.1|DR387956 RTHG1_25_G01.b1_A029 Roots plus adde... 40 0.11
gb|DR742164.1|DR742164 RTCU1_2_E02.b1_A029 Roots plus added... 40 0.11
gb|DR742182.1|DR742182 RTCU1_2_G04.b1_A029 Roots plus added... 40 0.11
gb|DR743561.1|DR743561 RTCU1_16_E10.g1_A029 Roots plus adde... 40 0.11
gb|DR745900.1|DR745900 RTCU1_33_G09.b1_A029 Roots plus adde... 40 0.11
gb|DR746180.1|DR746180 RTCU1_35_F04.b1_A029 Roots plus adde... 40 0.11
gb|DT628600.1|DT628600 EST1157349 Subtracted pine embryo li... 40 0.11
gb|BX253887.1|BX253887 BX253887 Pinus pinaster differenciat... 38 0.42
gb|BM903393.1|BM903393 NXRV_042_B07_F NXRV (Nsf Xylem Root ... 38 0.42
gb|BQ699990.1|BQ699990 NXRV132_F09_F NXRV (Nsf Xylem Root w... 38 0.42
gb|CD023612.1|CD023612 NXRV_003_E08_F NXRV (Nsf Xylem Root ... 38 0.42
gb|CF470548.1|CF470548 RTDS1_13_G08.b1_A015 Drought-stresse... 38 0.42
gb|CF667194.1|CF667194 RTCNT1_28_F01.g1_A029 Root control P... 38 0.42
gb|CF667462.1|CF667462 RTCNT1_30_A08.g1_A029 Root control P... 38 0.42
gb|CF672198.1|CF672198 RTCNT1_62_B06.b1_A029 Root control P... 38 0.42
gb|BX681550.1|BX681550 BX681550 RS Pinus pinaster cDNA clon... 38 0.42
gb|CO157709.1|CO157709 FLD1_1_C05.g1_A029 Root flooded Pinu... 38 0.42
gb|CO157963.1|CO157963 FLD1_3_A03.g1_A029 Root flooded Pinu... 38 0.42
gb|CO157983.1|CO157983 FLD1_3_D03.g1_A029 Root flooded Pinu... 38 0.42
gb|CO158568.1|CO158568 FLD1_7_F04.g1_A029 Root flooded Pinu... 38 0.42
gb|CO158972.1|CO158972 FLD1_10_B02.g1_A029 Root flooded Pin... 38 0.42
gb|CO158991.1|CO158991 FLD1_10_D01.g1_A029 Root flooded Pin... 38 0.42
gb|CO159344.1|CO159344 FLD1_13_B08.b1_A029 Root flooded Pin... 38 0.42
gb|CO159720.1|CO159720 FLD1_15_H10.b1_A029 Root flooded Pin... 38 0.42
gb|CO159742.1|CO159742 FLD1_15_C03.g1_A029 Root flooded Pin... 38 0.42
gb|CO159775.1|CO159775 FLD1_15_F11.g1_A029 Root flooded Pin... 38 0.42
gb|CO159804.1|CO159804 FLD1_16_C03.b1_A029 Root flooded Pin... 38 0.42
gb|CO159878.1|CO159878 FLD1_16_D03.g1_A029 Root flooded Pin... 38 0.42
gb|CO159894.1|CO159894 FLD1_16_F01.g1_A029 Root flooded Pin... 38 0.42
gb|CO160230.1|CO160230 FLD1_19_D04.g1_A029 Root flooded Pin... 38 0.42
gb|CO160439.1|CO160439 FLD1_21_B03.b1_A029 Root flooded Pin... 38 0.42
gb|CO160591.1|CO160591 FLD1_22_D03.b1_A029 Root flooded Pin... 38 0.42
gb|CO161817.1|CO161817 FLD1_31_H01.b1_A029 Root flooded Pin... 38 0.42
gb|CO161874.1|CO161874 FLD1_31_F01.g1_A029 Root flooded Pin... 38 0.42
gb|CO161895.1|CO161895 FLD1_31_H01.g1_A029 Root flooded Pin... 38 0.42
gb|CO161948.1|CO161948 FLD1_32_E06.b1_A029 Root flooded Pin... 38 0.42
gb|CO162022.1|CO162022 FLD1_32_E06.g1_A029 Root flooded Pin... 38 0.42
gb|CO162147.1|CO162147 FLD1_33_A12.g1_A029 Root flooded Pin... 38 0.42
gb|CO162374.1|CO162374 FLD1_34_H08.g1_A029 Root flooded Pin... 38 0.42
gb|CO162474.1|CO162474 FLD1_35_B09.g1_A029 Root flooded Pin... 38 0.42
gb|CO162810.1|CO162810 FLD1_37_D10.g1_A029 Root flooded Pin... 38 0.42
gb|CO163425.1|CO163425 FLD1_41_C09.g1_A029 Root flooded Pin... 38 0.42
gb|CO163532.1|CO163532 FLD1_42_E12.b1_A029 Root flooded Pin... 38 0.42
gb|CO163824.1|CO163824 FLD1_44_B07.b1_A029 Root flooded Pin... 38 0.42
gb|CO163902.1|CO163902 FLD1_44_B07.g1_A029 Root flooded Pin... 38 0.42
gb|CO164048.1|CO164048 FLD1_45_B02.g1_A029 Root flooded Pin... 38 0.42
gb|CO164120.1|CO164120 FLD1_46_A06.b1_A029 Root flooded Pin... 38 0.42
gb|CO164274.1|CO164274 FLD1_47_A06.b1_A029 Root flooded Pin... 38 0.42
gb|CO164293.1|CO164293 FLD1_47_C07.b1_A029 Root flooded Pin... 38 0.42
gb|CO164610.1|CO164610 FLD1_49_D12.b1_A029 Root flooded Pin... 38 0.42
gb|CO164680.1|CO164680 FLD1_49_C12.g1_A029 Root flooded Pin... 38 0.42
gb|CO164781.1|CO164781 FLD1_50_F10.b1_A029 Root flooded Pin... 38 0.42
gb|CO164913.1|CO164913 FLD1_51_C10.b1_A029 Root flooded Pin... 38 0.42
gb|CO165043.1|CO165043 FLD1_52_A11.b1_A029 Root flooded Pin... 38 0.42
gb|CO165115.1|CO165115 FLD1_52_A11.g1_A029 Root flooded Pin... 38 0.42
gb|CO165643.1|CO165643 FLD1_56_B04.b1_A029 Root flooded Pin... 38 0.42
gb|CO165711.1|CO165711 FLD1_56_B04.g1_A029 Root flooded Pin... 38 0.42
gb|CO166337.1|CO166337 FLD1_61_F01.b1_A029 Root flooded Pin... 38 0.42
gb|CO166361.1|CO166361 FLD1_61_H12.b1_A029 Root flooded Pin... 38 0.42
gb|CO166863.1|CO166863 FLD1_65_C05.b1_A029 Root flooded Pin... 38 0.42
gb|CO167129.1|CO167129 FLD1_67_B07.b1_A029 Root flooded Pin... 38 0.42
gb|CO167198.1|CO167198 FLD1_67_B07.g1_A029 Root flooded Pin... 38 0.42
gb|CO167602.1|CO167602 FLD1_70_A12.b1_A029 Root flooded Pin... 38 0.42
gb|CO366781.1|CO366781 RTK1_30_B12.b1_A029 Roots minus pota... 38 0.42
gb|CV031846.1|CV031846 RTNACL1_4_C06.b1_A029 Roots plus add... 38 0.42
gb|CV032600.1|CV032600 RTNACL1_17_E11.b1_A029 Roots plus ad... 38 0.42
gb|CV032685.1|CV032685 RTNACL1_17_E11.g1_A029 Roots plus ad... 38 0.42
gb|CV033686.1|CV033686 RTNACL1_36_B09.b1_A029 Roots plus ad... 38 0.42
gb|CV033887.1|CV033887 RTNACL1_37_E10.b1_A029 Roots plus ad... 38 0.42
gb|CV033904.1|CV033904 RTNACL1_37_G06.b1_A029 Roots plus ad... 38 0.42
gb|CV034901.1|CV034901 RTNACL1_12_H03.b1_A029 Roots plus ad... 38 0.42
gb|CV034962.1|CV034962 RTNACL1_12_F05.g1_A029 Roots plus ad... 38 0.42
gb|CV035007.1|CV035007 RTNACL1_13_B12.b1_A029 Roots plus ad... 38 0.42
gb|CV035014.1|CV035014 RTNACL1_13_C10.b1_A029 Roots plus ad... 38 0.42
gb|CV035730.1|CV035730 RTNACL1_42_C06.b1_A029 Roots plus ad... 38 0.42
gb|CV036025.1|CV036025 RTNACL1_44_D04.b1_A029 Roots plus ad... 38 0.42
gb|CX646662.1|CX646662 COLD1_10_E12.g1_A029 Root cold Pinus... 38 0.42
gb|CX646854.1|CX646854 COLD1_12_A06.b1_A029 Root cold Pinus... 38 0.42
gb|CX646934.1|CX646934 COLD1_12_A06.g1_A029 Root cold Pinus... 38 0.42
gb|CX647599.1|CX647599 COLD1_18_F12.b1_A029 Root cold Pinus... 38 0.42
gb|CX647883.1|CX647883 COLD1_25_D05.b1_A029 Root cold Pinus... 38 0.42
gb|CX647901.1|CX647901 COLD1_25_F01.b1_A029 Root cold Pinus... 38 0.42
gb|CX647958.1|CX647958 COLD1_25_D05.g1_A029 Root cold Pinus... 38 0.42
gb|CX648051.1|CX648051 COLD1_26_E12.b1_A029 Root cold Pinus... 38 0.42
gb|CX648114.1|CX648114 COLD1_26_D01.g1_A029 Root cold Pinus... 38 0.42
gb|CX648201.1|CX648201 COLD1_27_D08.b1_A029 Root cold Pinus... 38 0.42
gb|CX648252.1|CX648252 COLD1_27_B01.g1_A029 Root cold Pinus... 38 0.42
gb|CX649764.1|CX649764 COLD1_41_H02.b1_A029 Root cold Pinus... 38 0.42
gb|CX649850.1|CX649850 COLD1_41_H02.g1_A029 Root cold Pinus... 38 0.42
gb|CX649929.1|CX649929 COLD1_42_A01.g1_A029 Root cold Pinus... 38 0.42
gb|CX650345.1|CX650345 COLD1_45_C03.b1_A029 Root cold Pinus... 38 0.42
gb|CX650364.1|CX650364 COLD1_45_E04.b1_A029 Root cold Pinus... 38 0.42
gb|CX650440.1|CX650440 COLD1_45_E04.g1_A029 Root cold Pinus... 38 0.42
gb|CX652764.1|CX652764 COLD1_61_G06.b1_A029 Root cold Pinus... 38 0.42
gb|CX652859.1|CX652859 COLD1_62_A04.b1_A029 Root cold Pinus... 38 0.42
gb|CX652870.1|CX652870 COLD1_62_B06.b1_A029 Root cold Pinus... 38 0.42
gb|CX652939.1|CX652939 COLD1_62_A04.g1_A029 Root cold Pinus... 38 0.42
gb|CX653108.1|CX653108 COLD1_63_A09.g1_A029 Root cold Pinus... 38 0.42
gb|DR010946.1|DR010946 HEAT1_2_G05.b1_A029 Root at 37 C for... 38 0.42
gb|DR011484.1|DR011484 HEAT1_6_B05.b1_A029 Root at 37 C for... 38 0.42
gb|DR011518.1|DR011518 HEAT1_6_E09.b1_A029 Root at 37 C for... 38 0.42
gb|DR012332.1|DR012332 HEAT1_12_B10.b1_A029 Root at 37 C fo... 38 0.42
gb|DR013114.1|DR013114 HEAT1_17_C11.b1_A029 Root at 37 C fo... 38 0.42
gb|DR013248.1|DR013248 HEAT1_18_D05.b1_A029 Root at 37 C fo... 38 0.42
gb|DR013323.1|DR013323 HEAT1_18_D05.g1_A029 Root at 37 C fo... 38 0.42
gb|DR014520.1|DR014520 HEAT1_50_B02.b1_A029 Root at 37 C fo... 38 0.42
gb|DR015857.1|DR015857 STRS1_6_C12.b1_A034 Shoot tip pitch ... 38 0.42
gb|DR016310.1|DR016310 STRS1_9_G10.b1_A034 Shoot tip pitch ... 38 0.42
gb|DR016398.1|DR016398 STRS1_9_G10.g1_A034 Shoot tip pitch ... 38 0.42
gb|DR047416.1|DR047416 RTBOR1_1_A04.b1_A029 Roots plus adde... 38 0.42
gb|DR047998.1|DR047998 RTBOR1_6_A09.b2_A029 Roots plus adde... 38 0.42
gb|DR048459.1|DR048459 RTBOR1_9_C06.b1_A029 Roots plus adde... 38 0.42
gb|DR048538.1|DR048538 RTBOR1_9_C06.g1_A029 Roots plus adde... 38 0.42
gb|DR049656.1|DR049656 RTBOR1_18_E06.b1_A029 Roots plus add... 38 0.42
gb|DR051885.1|DR051885 RTCA1_1_C03.b1_A029 Roots minus calc... 38 0.42
gb|DR052094.1|DR052094 RTCA1_2_H08.b1_A029 Roots minus calc... 38 0.42
gb|DR052791.1|DR052791 RTCA1_6_H06.g1_A029 Roots minus calc... 38 0.42
gb|DR053096.1|DR053096 RTCA1_9_B01.b1_A029 Roots minus calc... 38 0.42
gb|DR069990.1|DR069990 RTDK1_10_D04.g1_A029 Roots, dark Pin... 38 0.42
gb|DR070953.1|DR070953 RTDK1_16_D09.g1_A029 Roots, dark Pin... 38 0.42
gb|DR071037.1|DR071037 RTDK1_17_E09.b1_A029 Roots, dark Pin... 38 0.42
gb|DR071338.1|DR071338 RTDK1_19_E08.b1_A029 Roots, dark Pin... 38 0.42
gb|DR071370.1|DR071370 RTDK1_19_H11.b1_A029 Roots, dark Pin... 38 0.42
gb|DR071692.1|DR071692 RTDK1_21_B10.g1_A029 Roots, dark Pin... 38 0.42
gb|DR072120.1|DR072120 RTDK1_24_E09.b1_A029 Roots, dark Pin... 38 0.42
gb|DR072199.1|DR072199 RTDK1_24_E09.g1_A029 Roots, dark Pin... 38 0.42
gb|DR079083.1|DR079083 RTFEPL1_9_A11.b1_A029 Roots plus add... 38 0.42
gb|DR079100.1|DR079100 RTFEPL1_9_C08.b1_A029 Roots plus add... 38 0.42
gb|DR079587.1|DR079587 RTFEPL1_12_F09.b1_A029 Roots plus ad... 38 0.42
gb|DR080025.1|DR080025 RTFEPL1_19_D03.g1_A029 Roots plus ad... 38 0.42
gb|DR080561.1|DR080561 RTFEPL1_23_C09.g1_A029 Roots plus ad... 38 0.42
gb|DR089658.1|DR089658 RTAL1_10_C03.b1_A029 Roots plus adde... 38 0.42
gb|DR089694.1|DR089694 RTAL1_10_F05.b1_A029 Roots plus adde... 38 0.42
gb|DR090019.1|DR090019 RTAL1_12_F03.b1_A029 Roots plus adde... 38 0.42
gb|DR090038.1|DR090038 RTAL1_12_G12.b1_A029 Roots plus adde... 38 0.42
gb|DR090226.1|DR090226 RTAL1_13_C08.g1_A029 Roots plus adde... 38 0.42
gb|DR090572.1|DR090572 RTAL1_16_B04.b1_A029 Roots plus adde... 38 0.42
gb|DR090647.1|DR090647 RTAL1_16_B04.g1_A029 Roots plus adde... 38 0.42
gb|DR091075.1|DR091075 RTAL1_19_F03.b1_A029 Roots plus adde... 38 0.42
gb|DR091635.1|DR091635 RTAL1_23_A05.b1_A029 Roots plus adde... 38 0.42
gb|DR091652.1|DR091652 RTAL1_23_C02.b1_A029 Roots plus adde... 38 0.42
gb|DR091726.1|DR091726 RTAL1_23_C02.g1_A029 Roots plus adde... 38 0.42
gb|DR092257.1|DR092257 RTAL1_28_A07.b1_A029 Roots plus adde... 38 0.42
gb|DR110324.1|DR110324 RTS1_10_F03.b1_A029 Roots minus sulf... 38 0.42
gb|DR165533.1|DR165533 RTPHOS1_5_E05.g1_A029 Roots minus ph... 38 0.42
gb|DR165793.1|DR165793 RTPHOS1_7_H02.b1_A029 Roots minus ph... 38 0.42
gb|DR167776.1|DR167776 RTPHOS1_21_A11.b1_A029 Roots minus p... 38 0.42
gb|DR168323.1|DR168323 RTPHOS1_24_E07.g1_A029 Roots minus p... 38 0.42
gb|DR168408.1|DR168408 RTPHOS1_25_F07.b1_A029 Roots minus p... 38 0.42
gb|DR168483.1|DR168483 RTPHOS1_25_F07.g1_A029 Roots minus p... 38 0.42
gb|DR169347.1|DR169347 RTPHOS1_31_F05.g1_A029 Roots minus p... 38 0.42
gb|DR384340.1|DR384340 RTHG1_1_C12.g1_A029 Roots plus added... 38 0.42
gb|DR384391.1|DR384391 RTHG1_2_A04.b1_A029 Roots plus added... 38 0.42
gb|DR384762.1|DR384762 RTHG1_4_A04.g1_A029 Roots plus added... 38 0.42
gb|DR385444.1|DR385444 RTHG1_8_E08.g1_A029 Roots plus added... 38 0.42
gb|DR385906.1|DR385906 RTHG1_11_C09.g1_A029 Roots plus adde... 38 0.42
gb|DR386116.1|DR386116 RTHG1_13_B12.b1_A029 Roots plus adde... 38 0.42
gb|DR386139.1|DR386139 RTHG1_13_E07.b1_A029 Roots plus adde... 38 0.42
gb|DR386204.1|DR386204 RTHG1_13_C12.g1_A029 Roots plus adde... 38 0.42
gb|DR386551.1|DR386551 RTHG1_16_A06.b1_A029 Roots plus adde... 38 0.42
gb|DR386695.1|DR386695 RTHG1_16_G10.g1_A029 Roots plus adde... 38 0.42
gb|DR388388.1|DR388388 RTHG1_28_A06.b1_A029 Roots plus adde... 38 0.42
gb|DR388684.1|DR388684 RTHG1_29_G11.g1_A029 Roots plus adde... 38 0.42
gb|DR388764.1|DR388764 RTHG1_30_G12.b1_A029 Roots plus adde... 38 0.42
gb|DR388866.1|DR388866 RTHG1_31_A03.b1_A029 Roots plus adde... 38 0.42
gb|DR742006.1|DR742006 RTCU1_1_D04.b1_A029 Roots plus added... 38 0.42
gb|DR742087.1|DR742087 RTCU1_1_D07.g1_A029 Roots plus added... 38 0.42
gb|DR742101.1|DR742101 RTCU1_1_F01.g1_A029 Roots plus added... 38 0.42
gb|DR742222.1|DR742222 RTCU1_2_C10.g1_A029 Roots plus added... 38 0.42
gb|DR742390.1|DR742390 RTCU1_3_E09.g2_A029 Roots plus added... 38 0.42
gb|DR742796.1|DR742796 RTCU1_7_C03.b2_A029 Roots plus added... 38 0.42
gb|DR743337.1|DR743337 RTCU1_15_E01.b1_A029 Roots plus adde... 38 0.42
gb|DR743633.1|DR743633 RTCU1_17_E04.b1_A029 Roots plus adde... 38 0.42
gb|DR743707.1|DR743707 RTCU1_17_E04.g1_A029 Roots plus adde... 38 0.42
gb|DR743797.1|DR743797 RTCU1_18_E12.b1_A029 Roots plus adde... 38 0.42
gb|DR744251.1|DR744251 RTCU1_21_E11.b1_A029 Roots plus adde... 38 0.42
gb|DR744296.1|DR744296 RTCU1_21_B11.g1_A029 Roots plus adde... 38 0.42
gb|DR744323.1|DR744323 RTCU1_21_E11.g1_A029 Roots plus adde... 38 0.42
gb|DR744513.1|DR744513 RTCU1_23_A10.b1_A029 Roots plus adde... 38 0.42
gb|DR746415.1|DR746415 RTCU1_36_G01.g1_A029 Roots plus adde... 38 0.42
>gb|AA739750.1|AA739750 515 PtIFG2 Pinus taeda cDNA clone 8831M 3', mRNA sequence
Length = 451
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 136 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 180
>gb|AW064862.1|AW064862 ST36G02 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST36G02, mRNA sequence
Length = 556
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 159 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 203
>gb|AL750057.1|AL750057 AL750057 AS Pinus pinaster cDNA clone AS05C09 similar to RP L29,
mRNA sequence
Length = 192
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 140 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 184
>gb|AL750066.1|AL750066 AL750066 AS Pinus pinaster cDNA clone AS05D06 similar to RP L29,
mRNA sequence
Length = 525
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 140 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 184
>gb|AL750433.1|AL750433 AL750433 RN Pinus pinaster cDNA clone RN02E01 similar to RP L29,
mRNA sequence
Length = 506
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 148 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 192
>gb|BX250562.1|BX250562 BX250562 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP038E10 similar to 60S RIBOSOMAL PROTEIN
L29, mRNA sequence
Length = 418
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 148 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 192
>gb|BX253067.1|BX253067 BX253067 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP077D12 similar to 60S RIBOSOMAL PROTEIN
L29, mRNA sequence
Length = 534
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 148 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 192
>gb|BX253197.1|BX253197 BX253197 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP079F06, mRNA sequence
Length = 543
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 146 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 190
>gb|BX253596.1|BX253596 BX253596 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP085G02 similar to 60S RIBOSOMAL PROTEIN
L29, mRNA sequence
Length = 526
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 146 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 190
>gb|BX254128.1|BX254128 BX254128 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP093G10, mRNA sequence
Length = 523
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 140 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 184
>gb|BX254430.1|BX254430 BX254430 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP098E06 similar to 60S RIBOSOMAL PROTEIN
L29, mRNA sequence
Length = 534
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 146 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 190
>gb|BX255376.1|BX255376 BX255376 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP005B03 similar to 60S RIBOSOMAL PROTEIN
L29, mRNA sequence
Length = 571
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 148 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 192
>gb|BE496472.1|BE496472 NXCI_018_E06_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_018_E06 5' similar to Arabidopsis
thaliana sequence At3g06700 ribosomal protein L29,
putative see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 519
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 123 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 167
>gb|BF220655.1|BF220655 NXCI_151_B08_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_151_B08 5' similar to Arabidopsis
thaliana sequence At3g06700 ribosomal protein L29,
putative see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 308
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 123 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 167
>gb|BF777488.1|BF777488 NXSI_069_B08_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_069_B08 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 438
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 141 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 185
>gb|BG040067.1|BG040067 NXSI_106_A02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_106_A02 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 539
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 141 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 185
>gb|BG275893.1|BG275893 NXSI_149_B12_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_149_B12 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 511
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 153 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 197
>gb|BM427978.1|BM427978 NXRV_007_B01_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_007_B01 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 376
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 151 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 195
Score = 38.2 bits (19), Expect = 0.42
Identities = 58/71 (81%)
Strand = Plus / Plus
Query: 129 atggccaagtcgaagaaccacacggcgcacaaccagtcgttcaaggcgcacaagaacggc 188
||||| ||||| ||||| ||||| || |||||||| || | |||| |||||||| ||
Sbjct: 52 atggcaaagtcaaagaatcacacagctcacaaccaatcttacaagaatcacaagaatgga 111
Query: 189 attaagaagcc 199
|||||||||||
Sbjct: 112 attaagaagcc 122
>gb|BM427981.1|BM427981 NXRV_007_B07_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_007_B07 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 333
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 151 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 195
>gb|BM492562.1|BM492562 NXRV_028_B03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_028_B03 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 431
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 151 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 195
>gb|BQ701602.1|BQ701602 NXSI_111_E05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_111_E05 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 539
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 141 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 185
>gb|CD017537.1|CD017537 NXCI_124_H03_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_124_H03 5' similar to Arabidopsis
thaliana sequence At3g06700 ribosomal protein L29,
putative see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 134
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 22 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 66
>gb|BX681303.1|BX681303 BX681303 RS Pinus pinaster cDNA clone RS56G05, mRNA sequence
Length = 465
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 79 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 123
>gb|BX681367.1|BX681367 BX681367 RS Pinus pinaster cDNA clone RS57G05, mRNA sequence
Length = 237
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 82 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 126
>gb|BX682309.2|BX682309 BX682309 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 114H10 similar to 60S ribosomal protein L29,
mRNA sequence
Length = 563
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 150 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 194
>gb|CR392485.1|CR392485 CR392485 RN Pinus pinaster cDNA clone RN33A11, mRNA sequence
Length = 523
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 215 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 259
>gb|DN627075.1|DN627075 EST977891 Subtracted pine embryo library, Lib_C Pinus taeda cDNA
clone PTAAD96, mRNA sequence
Length = 403
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 179 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 223
>gb|DN627179.1|DN627179 EST977995 Subtracted pine embryo library, Lib_C Pinus taeda cDNA
clone PTAAF47, mRNA sequence
Length = 394
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 170 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 214
>gb|DN632513.1|DN632513 EST983329 Subtracted pine embryo library, Lib_C Pinus taeda cDNA
clone PTACQ17, mRNA sequence
Length = 394
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 170 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 214
>gb|DN633693.1|DN633693 EST984509 Subtracted pine embryo library, Lib_C Pinus taeda cDNA
clone PTADA52, mRNA sequence
Length = 394
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 170 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 214
>gb|DN633772.1|DN633772 EST984588 Subtracted pine embryo library, Lib_C Pinus taeda cDNA
clone PTADB75, mRNA sequence
Length = 399
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 225 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 181
>gb|DN633894.1|DN633894 EST984710 Subtracted pine embryo library, Lib_C Pinus taeda cDNA
clone PTADD68, mRNA sequence
Length = 393
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 225 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 181
>gb|DN634507.1|DN634507 EST985323 Subtracted pine embryo library, Lib_C Pinus taeda cDNA
clone PTADN68, mRNA sequence
Length = 394
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 170 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 214
>gb|DR686678.1|DR686678 EST1076756 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABI65 3' end, mRNA sequence
Length = 571
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| ||||||| ||||||||
Sbjct: 166 gggatggacccaaagttcctaagaaaccagaggtatgctaggaag 210
>gb|CO163966.1|CO163966 FLD1_45_A08.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_45_A08_A029 3', mRNA sequence
Length = 892
Score = 46.1 bits (23), Expect = 0.002
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 476 ttaccttgtgcctaattcggcacgaggctcg 506
|||||| ||||| ||||||||||||||||||
Sbjct: 858 ttacctcgtgccgaattcggcacgaggctcg 888
>gb|DR025637.1|DR025637 STRS1_72_G09.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_72_G09_A034 5', mRNA sequence
Length = 564
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 483 gtgcctaattcggcacgaggctcgtct 509
||||| |||||||||||||||||||||
Sbjct: 420 gtgccgaattcggcacgaggctcgtct 446
>gb|BE662593.1|BE662593 ST88/ST88D04 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST88/ST88D04, mRNA sequence
Length = 386
Score = 44.1 bits (22), Expect = 0.007
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
|||||| |||| |||||||| || |||| ||||||| ||||||||
Sbjct: 166 gggatgnacccaaagttcctaagaaaccagaggtatgctaggaag 210
>gb|CO368579.1|CO368579 RTK1_41_B07.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_41_B07_A029 5', mRNA sequence
Length = 735
Score = 44.1 bits (22), Expect = 0.007
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 474 gattaccttgtgcctaattcggcacgaggc 503
|||||||| ||||| |||||||||||||||
Sbjct: 660 gattacctcgtgccgaattcggcacgaggc 631
>gb|DR011795.1|DR011795 HEAT1_8_A08.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_8_A08_A029 3', mRNA sequence
Length = 637
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 483 gtgcctaattcggcacgaggctcgtc 508
||||| ||||||||||||||||||||
Sbjct: 633 gtgccgaattcggcacgaggctcgtc 608
>gb|DR743615.1|DR743615 RTCU1_17_B12.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_17_B12_A029 3', mRNA sequence
Length = 864
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 479 ccttgtgcctaattcggcacgaggct 504
||||||||| ||||||||||||||||
Sbjct: 859 ccttgtgccgaattcggcacgaggct 834
>gb|BM493575.1|BM493575 NXLV_066_F12_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_066_F12 5', mRNA sequence
Length = 271
Score = 42.1 bits (21), Expect = 0.027
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| |||||| ||||||||
Sbjct: 26 gggatggacccaaagttcctaagaaaccaaaggtatgctaggaag 70
>gb|BM493839.1|BM493839 NXLV_070_C06_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_070_C06 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 600
Score = 42.1 bits (21), Expect = 0.027
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| |||||| ||||||||
Sbjct: 177 gggatggacccaaagttcctaagaaaccaaaggtatgctaggaag 221
Score = 38.2 bits (19), Expect = 0.42
Identities = 58/71 (81%)
Strand = Plus / Plus
Query: 129 atggccaagtcgaagaaccacacggcgcacaaccagtcgttcaaggcgcacaagaacggc 188
||||| ||||| ||||| ||||| || |||||||| || | |||| |||||||| ||
Sbjct: 78 atggcaaagtcaaagaatcacacagctcacaaccaatcttacaagaatcacaagaatgga 137
Query: 189 attaagaagcc 199
|||||||||||
Sbjct: 138 attaagaagcc 148
>gb|BQ197167.1|BQ197167 NXLV110_C11_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV110_C11 5' similar to Arabidopsis thaliana
sequence At3g06700 ribosomal protein L29, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 640
Score = 42.1 bits (21), Expect = 0.027
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 228 gggatggaccccaagttcctgaggaacctgaggtattctaggaag 272
||||||||||| |||||||| || |||| |||||| ||||||||
Sbjct: 198 gggatggacccaaagttcctaagaaaccaaaggtatgctaggaag 242
Score = 38.2 bits (19), Expect = 0.42
Identities = 58/71 (81%)
Strand = Plus / Plus
Query: 129 atggccaagtcgaagaaccacacggcgcacaaccagtcgttcaaggcgcacaagaacggc 188
||||| ||||| ||||| ||||| || |||||||| || | |||| |||||||| ||
Sbjct: 99 atggcaaagtcaaagaatcacacagctcacaaccaatcttacaagaatcacaagaatgga 158
Query: 189 attaagaagcc 199
|||||||||||
Sbjct: 159 attaagaagcc 169
>gb|CF668206.1|CF668206 RTCNT1_35_C05.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_35_C05_A029 3', mRNA sequence
Length = 134
Score = 42.1 bits (21), Expect = 0.027
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 478 accttgtgcctaattcggcacgaggctcgtctc 510
|||| ||||| |||||||||||||||| |||||
Sbjct: 122 acctcgtgccgaattcggcacgaggctagtctc 90
>gb|CO159352.1|CO159352 FLD1_13_C07.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_13_C07_A029 3', mRNA sequence
Length = 351
Score = 42.1 bits (21), Expect = 0.027
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 483 gtgcctaattcggcacgaggctcgt 507
||||| |||||||||||||||||||
Sbjct: 79 gtgccgaattcggcacgaggctcgt 103
>gb|CO162755.1|CO162755 FLD1_37_G05.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_37_G05_A029 3', mRNA sequence
Length = 857
Score = 42.1 bits (21), Expect = 0.027
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 477 taccttgtgcctaattcggcacgaggctc 505
||||| ||||| |||||||||||||||||
Sbjct: 325 tacctcgtgccgaattcggcacgaggctc 297
>gb|CO162838.1|CO162838 FLD1_37_G05.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_37_G05_A029 5', mRNA sequence
Length = 879
Score = 42.1 bits (21), Expect = 0.027
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 477 taccttgtgcctaattcggcacgaggctc 505
||||| ||||| |||||||||||||||||
Sbjct: 416 tacctcgtgccgaattcggcacgaggctc 388
>gb|CO167884.1|CO167884 FLD1_71_H01.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_71_H01_A029 5', mRNA sequence
Length = 537
Score = 42.1 bits (21), Expect = 0.027
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 471 acggattaccttgtgcctaattcggcacgaggc 503
||||||| ||| ||||| |||||||||||||||
Sbjct: 161 acggattgcctcgtgccgaattcggcacgaggc 193
>gb|CX645736.1|CX645736 COLD1_5_B06.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_5_B06_A029 3', mRNA sequence
Length = 706
Score = 42.1 bits (21), Expect = 0.027
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 479 ccttgtgcctaattcggcacgaggc 503
||||||||| |||||||||||||||
Sbjct: 452 ccttgtgccgaattcggcacgaggc 428
>gb|CX649263.1|CX649263 COLD1_34_C09.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_34_C09_A029 3', mRNA sequence
Length = 833
Score = 42.1 bits (21), Expect = 0.027
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 479 ccttgtgcctaattcggcacgaggc 503
||||||||| |||||||||||||||
Sbjct: 830 ccttgtgccgaattcggcacgaggc 806
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 76,037
Number of Sequences: 355925
Number of extensions: 76037
Number of successful extensions: 24419
Number of sequences better than 0.5: 301
Number of HSP's better than 0.5 without gapping: 301
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 23689
Number of HSP's gapped (non-prelim): 730
length of query: 634
length of database: 217,277,237
effective HSP length: 19
effective length of query: 615
effective length of database: 210,514,662
effective search space: 129466517130
effective search space used: 129466517130
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)