BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3071483.2.1
(531 letters)
Database: Oryza_nucl_with_EST.fasta
438,736 sequences; 2,800,419,916 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AU183327.1|AU183327 AU183327 Rice cDNA from immature lea... 337 4e-090
ref|XM_475631.1| Oryza sativa (japonica cultivar-group), p... 337 4e-090
gb|AU165717.1|AU165717 AU165717 Rice panicle at flowering s... 329 9e-088
gb|CV721477.1|CV721477 YBH--04-E01.b1 Rice before heading y... 313 5e-083
gb|CV721494.1|CV721494 YBH--04-F01.b1 Rice before heading y... 313 5e-083
gb|AC104276.2| Oryza sativa (japonica cultivar-group) chrom... 311 2e-082
gb|AC137614.2| Oryza sativa (japonica cultivar-group) chrom... 311 2e-082
gb|AACV01010931.1| Oryza sativa (japonica cultivar-group) c... 311 2e-082
gb|AC119288.4| Oryza sativa (japonica cultivar-group) chrom... 311 2e-082
ref|NT_107216.1| Oryza sativa (japonica cultivar-group) 311 2e-082
gb|CH401191.1| Oryza sativa (japonica cultivar-group) chrom... 311 2e-082
gb|CM000142.1| Oryza sativa (japonica cultivar-group) chrom... 311 2e-082
dbj|AP008211.1| Oryza sativa (japonica cultivar-group) geno... 311 2e-082
gb|AU184299.1|AU184299 AU184299 Rice root Oryza sativa (jap... 301 2e-079
gb|AU184331.1|AU184331 AU184331 Rice root Oryza sativa (jap... 301 2e-079
gb|AU182519.1|AU182519 AU182519 Rice panicle at flowering s... 299 8e-079
gb|AU184419.1|AU184419 AU184419 Rice root Oryza sativa (jap... 283 5e-074
gb|AU182670.1|AU182670 AU182670 Rice panicle (longer than 1... 278 3e-072
gb|AU183328.1|AU183328 AU183328 Rice cDNA from immature lea... 256 1e-065
gb|AU183333.1|AU183333 AU183333 Rice cDNA from immature lea... 250 7e-064
ref|XM_472424.1| Oryza sativa (japonica cultivar-group), p... 194 3e-047
gb|C99088.1|C99088 C99088 Rice panicle at flowering stage O... 188 2e-045
dbj|AK110485.1| Oryza sativa (japonica cultivar-group) cDNA... 188 2e-045
gb|CA756111.1|CA756111 BR030035000_PLATE_C06_43_040.ab1 OA ... 186 8e-045
emb|AL606451.1|OSJN00006 Oryza sativa (japonica cultivar-gr... 176 8e-042
gb|AACV01009713.1| Oryza sativa (japonica cultivar-group) c... 176 8e-042
ref|NT_107198.1| Oryza sativa (japonica cultivar-group) 176 8e-042
gb|CH401189.1| Oryza sativa (japonica cultivar-group) chrom... 176 8e-042
gb|CM000141.1| Oryza sativa (japonica cultivar-group) chrom... 176 8e-042
emb|AL606453.2|OSJN00010 Oryza sativa genomic DNA, chromoso... 176 8e-042
dbj|AP008210.1| Oryza sativa (japonica cultivar-group) geno... 176 8e-042
gb|AU184823.1|AU184823 AU184823 Rice cDNA from young root O... 174 3e-041
gb|C99089.1|C99089 C99089 Rice panicle at flowering stage O... 161 5e-037
gb|AU064186.1|AU064186 AU064186 Rice panicle at flowering s... 135 3e-029
gb|CV721235.1|CV721235 YBH--03-G09.b1 Rice before heading y... 119 2e-024
gb|CV721634.1|CV721634 YBH--04-M15.b1 Rice before heading y... 119 2e-024
ref|XM_472425.1| Oryza sativa (japonica cultivar-group), p... 119 2e-024
gb|D24434.1|D24434 RICR1885A Rice root Oryza sativa (japoni... 103 9e-020
gb|CV720933.1|CV720933 YBH--02-F09.b1 Rice before heading y... 103 9e-020
gb|CV721396.1|CV721396 YBH--03-P10.b1 Rice before heading y... 103 9e-020
gb|C73730.1|C73730 C73730 Rice panicle (longer than 10cm) O... 90 1e-015
gb|AU064024.1|AU064024 AU064024 Rice panicle at flowering s... 86 2e-014
gb|CV721349.1|CV721349 YBH--03-M13.b1 Rice before heading y... 86 2e-014
gb|CV721865.1|CV721865 YBH--05-J14.b1 Rice before heading y... 74 8e-011
dbj|AK062916.1| Oryza sativa (japonica cultivar-group) cDNA... 64 8e-008
dbj|AK105208.1| Oryza sativa (japonica cultivar-group) cDNA... 64 8e-008
dbj|BA000010.8| Oryza sativa (japonica cultivar-group) geno... 64 8e-008
ref|NT_079927.2| Oryza sativa (japonica cultivar-group) 64 8e-008
dbj|AP004127.1| Oryza sativa (japonica cultivar-group) geno... 64 8e-008
dbj|AP008207.1| Oryza sativa (japonica cultivar-group) geno... 64 8e-008
gb|AU184330.1|AU184330 AU184330 Rice root Oryza sativa (jap... 60 1e-006
gb|AQ913446.1|AQ913446 nbeb0041J21f CUGI Rice BAC Library (... 52 3e-004
gb|AACV01002674.1| Oryza sativa (japonica cultivar-group) c... 46 0.019
gb|CH401168.1| Oryza sativa (japonica cultivar-group) chrom... 46 0.019
gb|CM000138.1| Oryza sativa (japonica cultivar-group) chrom... 46 0.019
>gb|AU183327.1|AU183327 AU183327 Rice cDNA from immature leaf including apical meristem
(under short day condition) Oryza sativa (japonica
cultivar-group) cDNA clone E61684, mRNA sequence
Length = 444
Score = 337 bits (170), Expect = 4e-090
Identities = 242/266 (90%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 414 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 355
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 354 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 295
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgctg 411
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 294 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagctgctc 235
Query: 412 gtcggcgtggactgcgggtcgtcggcagccgagatgcatggcgccatccttagcgccacc 471
| ||||| |||||||||||||| || ||||| | ||| ||||||| || |||||||||
Sbjct: 234 gacggcgccgactgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacc 175
Query: 472 ctgtcggcggaggctctcccgcactc 497
| ||||||||| || |||||||||||
Sbjct: 174 cggtcggcggacgccctcccgcactc 149
>ref|XM_475631.1| Oryza sativa (japonica cultivar-group), predicted mRNA
Length = 354
Score = 337 bits (170), Expect = 4e-090
Identities = 242/266 (90%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 350 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 290 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 231
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgctg 411
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 230 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagctgctc 171
Query: 412 gtcggcgtggactgcgggtcgtcggcagccgagatgcatggcgccatccttagcgccacc 471
| ||||| |||||||||||||| || ||||| | ||| ||||||| || |||||||||
Sbjct: 170 gacggcgccgactgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacc 111
Query: 472 ctgtcggcggaggctctcccgcactc 497
| ||||||||| || |||||||||||
Sbjct: 110 cggtcggcggacgccctcccgcactc 85
>gb|AU165717.1|AU165717 AU165717 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E4182, mRNA sequence
Length = 676
Score = 329 bits (166), Expect = 9e-088
Identities = 241/266 (90%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 434 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 375
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 374 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 315
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgctg 411
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 314 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagctgctc 255
Query: 412 gtcggcgtggactgcgggtcgtcggcagccgagatgcatggcgccatccttagcgccacc 471
| ||||| |||||||||||||| || ||||| | ||| || |||| || |||||||||
Sbjct: 254 gacggcgccgactgcgggtcgtccgccgccgacacgcacggtgccagccgcagcgccacc 195
Query: 472 ctgtcggcggaggctctcccgcactc 497
| ||||||||| || |||||||||||
Sbjct: 194 cggtcggcggacgccctcccgcactc 169
>gb|CV721477.1|CV721477 YBH--04-E01.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--04-E01, mRNA sequence
Length = 460
Score = 313 bits (158), Expect = 5e-083
Identities = 227/250 (90%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 224
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 223 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 164
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgctg 411
||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||
Sbjct: 163 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagatgctc 104
Query: 412 gtcggcgtggactgcgggtcgtcggcagccgagatgcatggcgccatccttagcgccacc 471
| ||||| |||||||||||||| || ||||| | ||| ||||||| || |||||||||
Sbjct: 103 gacggcgccgactgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacc 44
Query: 472 ctgtcggcgg 481
| ||||||||
Sbjct: 43 cggtcggcgg 34
>gb|CV721494.1|CV721494 YBH--04-F01.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--04-F01, mRNA sequence
Length = 460
Score = 313 bits (158), Expect = 5e-083
Identities = 227/250 (90%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 224
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 223 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 164
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgctg 411
||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||
Sbjct: 163 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagatgctc 104
Query: 412 gtcggcgtggactgcgggtcgtcggcagccgagatgcatggcgccatccttagcgccacc 471
| ||||| |||||||||||||| || ||||| | ||| ||||||| || |||||||||
Sbjct: 103 gacggcgccgactgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacc 44
Query: 472 ctgtcggcgg 481
| ||||||||
Sbjct: 43 cggtcggcgg 34
>gb|AC104276.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1231_F08,
complete sequence
Length = 118049
Score = 311 bits (157), Expect = 2e-082
Identities = 229/253 (90%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 47418 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 47477
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
|||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||
Sbjct: 47478 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 47537
Query: 365 agctggggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggact 424
|||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||
Sbjct: 47538 agctggggctctgcccgatggtgtgcaccgccgagcagcagctgctcgacggcgccgact 47597
Query: 425 gcgggtcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggagg 484
|||||||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |
Sbjct: 47598 gcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacccggtcggcggacg 47657
Query: 485 ctctcccgcactc 497
| |||||||||||
Sbjct: 47658 ccctcccgcactc 47670
>gb|AC137614.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
OSJNBa0034O12, complete sequence
Length = 156263
Score = 311 bits (157), Expect = 2e-082
Identities = 229/253 (90%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 45767 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 45826
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
|||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||
Sbjct: 45827 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 45886
Query: 365 agctggggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggact 424
|||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||
Sbjct: 45887 agctggggctctgcccgatggtgtgcaccgccgagcagcagctgctcgacggcgccgact 45946
Query: 425 gcgggtcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggagg 484
|||||||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |
Sbjct: 45947 gcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacccggtcggcggacg 46006
Query: 485 ctctcccgcactc 497
| |||||||||||
Sbjct: 46007 ccctcccgcactc 46019
>gb|AACV01010931.1| Oryza sativa (japonica cultivar-group) chromosome 5 Ctg010931, whole
genome shotgun sequence
Length = 25588
Score = 311 bits (157), Expect = 2e-082
Identities = 229/253 (90%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 4819 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 4760
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
|||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||
Sbjct: 4759 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 4700
Query: 365 agctggggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggact 424
|||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||
Sbjct: 4699 agctggggctctgcccgatggtgtgcaccgccgagcagcagctgctcgacggcgccgact 4640
Query: 425 gcgggtcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggagg 484
|||||||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |
Sbjct: 4639 gcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacccggtcggcggacg 4580
Query: 485 ctctcccgcactc 497
| |||||||||||
Sbjct: 4579 ccctcccgcactc 4567
>gb|AC119288.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017J22,
complete sequence
Length = 177153
Score = 311 bits (157), Expect = 2e-082
Identities = 229/253 (90%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 109618 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 109677
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
|||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||
Sbjct: 109678 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 109737
Query: 365 agctggggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggact 424
|||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||
Sbjct: 109738 agctggggctctgcccgatggtgtgcaccgccgagcagcagctgctcgacggcgccgact 109797
Query: 425 gcgggtcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggagg 484
|||||||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |
Sbjct: 109798 gcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacccggtcggcggacg 109857
Query: 485 ctctcccgcactc 497
| |||||||||||
Sbjct: 109858 ccctcccgcactc 109870
>ref|NT_107216.1| Oryza sativa (japonica cultivar-group)
Length = 2910826
Score = 311 bits (157), Expect = 2e-082
Identities = 229/253 (90%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 2570523 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 2570582
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
|||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||
Sbjct: 2570583 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 2570642
Query: 365 agctggggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggact 424
|||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||
Sbjct: 2570643 agctggggctctgcccgatggtgtgcaccgccgagcagcagctgctcgacggcgccgact 2570702
Query: 425 gcgggtcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggagg 484
|||||||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |
Sbjct: 2570703 gcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacccggtcggcggacg 2570762
Query: 485 ctctcccgcactc 497
| |||||||||||
Sbjct: 2570763 ccctcccgcactc 2570775
>gb|CH401191.1| Oryza sativa (japonica cultivar-group) chromosome 5 scaffold000028 genomic
scaffold, whole genome shotgun sequence
Length = 7678539
Score = 311 bits (157), Expect = 2e-082
Identities = 229/253 (90%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 3491497 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 3491556
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
|||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||
Sbjct: 3491557 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 3491616
Query: 365 agctggggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggact 424
|||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||
Sbjct: 3491617 agctggggctctgcccgatggtgtgcaccgccgagcagcagctgctcgacggcgccgact 3491676
Query: 425 gcgggtcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggagg 484
|||||||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |
Sbjct: 3491677 gcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacccggtcggcggacg 3491736
Query: 485 ctctcccgcactc 497
| |||||||||||
Sbjct: 3491737 ccctcccgcactc 3491749
>gb|CM000142.1| Oryza sativa (japonica cultivar-group) chromosome 5, whole genome shotgun
sequence
Length = 29309110
Score = 311 bits (157), Expect = 2e-082
Identities = 229/253 (90%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 3491497 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 3491556
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
|||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||
Sbjct: 3491557 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 3491616
Query: 365 agctggggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggact 424
|||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||
Sbjct: 3491617 agctggggctctgcccgatggtgtgcaccgccgagcagcagctgctcgacggcgccgact 3491676
Query: 425 gcgggtcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggagg 484
|||||||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |
Sbjct: 3491677 gcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacccggtcggcggacg 3491736
Query: 485 ctctcccgcactc 497
| |||||||||||
Sbjct: 3491737 ccctcccgcactc 3491749
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
sequence
Length = 29737217
Score = 311 bits (157), Expect = 2e-082
Identities = 229/253 (90%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 3480136 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 3480195
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
|||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||
Sbjct: 3480196 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 3480255
Query: 365 agctggggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggact 424
|||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||
Sbjct: 3480256 agctggggctctgcccgatggtgtgcaccgccgagcagcagctgctcgacggcgccgact 3480315
Query: 425 gcgggtcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggagg 484
|||||||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |
Sbjct: 3480316 gcgggtcgtccgccgccgacacgcacggcgccagccgcagcgccacccggtcggcggacg 3480375
Query: 485 ctctcccgcactc 497
| |||||||||||
Sbjct: 3480376 ccctcccgcactc 3480388
>gb|AU184299.1|AU184299 AU184299 Rice root Oryza sativa (japonica cultivar-group) cDNA
clone R1885, mRNA sequence
Length = 449
Score = 301 bits (152), Expect = 2e-079
Identities = 197/212 (92%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 212 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 153
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 152 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 93
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgctg 411
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 92 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagctgctc 33
Query: 412 gtcggcgtggactgcgggtcgtcggcagccga 443
| ||||| |||||||||||||| || |||||
Sbjct: 32 gacggcgccgactgcgggtcgtccgccgccga 1
>gb|AU184331.1|AU184331 AU184331 Rice root Oryza sativa (japonica cultivar-group) cDNA
clone R1979, mRNA sequence
Length = 451
Score = 301 bits (152), Expect = 2e-079
Identities = 197/212 (92%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 214 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 155
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 154 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 95
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgctg 411
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 94 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagctgctc 35
Query: 412 gtcggcgtggactgcgggtcgtcggcagccga 443
| ||||| |||||||||||||| || |||||
Sbjct: 34 gacggcgccgactgcgggtcgtccgccgccga 3
>gb|AU182519.1|AU182519 AU182519 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E3418, mRNA sequence
Length = 453
Score = 299 bits (151), Expect = 8e-079
Identities = 190/203 (93%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 209 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 150
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 149 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 90
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgctg 411
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 89 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagctgctc 30
Query: 412 gtcggcgtggactgcgggtcgtc 434
| ||||| ||||||||||||||
Sbjct: 29 gacggcgccgactgcgggtcgtc 7
>gb|AU184419.1|AU184419 AU184419 Rice root Oryza sativa (japonica cultivar-group) cDNA
clone R2228, mRNA sequence
Length = 454
Score = 283 bits (143), Expect = 5e-074
Identities = 170/179 (94%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 179 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 120
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 119 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 60
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgct 410
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 59 acggcgcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagctgct 1
>gb|AU182670.1|AU182670 AU182670 Rice panicle (longer than 10cm) Oryza sativa (japonica
cultivar-group) cDNA clone E20278, mRNA sequence
Length = 443
Score = 278 bits (140), Expect = 3e-072
Identities = 169/179 (94%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 186 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 127
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||||||||||||||| ||||||| ||| |||||||||
Sbjct: 126 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 67
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgct 410
||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 66 acggcgcacaggcagctggggctntgcccgatggtgtgcaccgccgagcagcagctgct 8
>gb|AU183328.1|AU183328 AU183328 Rice cDNA from immature leaf including apical meristem
(under short day condition) Oryza sativa (japonica
cultivar-group) cDNA clone E61684, mRNA sequence
Length = 438
Score = 256 bits (129), Expect = 1e-065
Identities = 162/174 (93%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 174 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 115
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| |||||||||||||| ||||||||||| ||||||| ||| |||||||||
Sbjct: 114 gggatggtgatggcgacctccggnttgatcccggcgaccctggccgtgttggacagcatc 55
Query: 352 acggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcag 405
|||| |||||||||| ||||||||||||||||||||||||| || |||||||||
Sbjct: 54 acggngcacaggcagntggggctctgcccgatggtgtgcaccgccgagcagcag 1
>gb|AU183333.1|AU183333 AU183333 Rice cDNA from immature leaf including apical meristem
(under short day condition) Oryza sativa (japonica
cultivar-group) cDNA clone E61773, mRNA sequence
Length = 439
Score = 250 bits (126), Expect = 7e-064
Identities = 167/180 (92%), Gaps = 1/180 (0%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 196 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 137
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctgg-cggtgccggacagcat 350
|||||||| ||||||||||||||||| ||||| || |||||| | ||| |||||||||
Sbjct: 136 gggatggtgatggcgacctccggcttnatcccngcgaccctggcccgtgttggacagcat 77
Query: 351 gacggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagcagctgct 410
|||| |||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 76 cacggggcacaggcagctggggctctgcccgatggtgtgcaccgccgagcagcagctgct 17
>ref|XM_472424.1| Oryza sativa (japonica cultivar-group), predicted mRNA
Length = 351
Score = 194 bits (98), Expect = 3e-047
Identities = 148/164 (90%), Gaps = 3/164 (1%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 347 ggcagagtgtaatctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttg 288
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| ||||||||||| |||||||||||||| ||||| |||| ||||||||||
Sbjct: 287 gggatggtgatggcgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatg 228
Query: 352 acggcgcacaggcagctggggctctg---cccgatggtgtgcac 392
|||||||| ||||| |||||||||| |||||||||||||||
Sbjct: 227 acggcgcagaggcacttggggctctgcttcccgatggtgtgcac 184
>gb|C99088.1|C99088 C99088 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E4433_1A, mRNA sequence
Length = 249
Score = 188 bits (95), Expect = 2e-045
Identities = 201/237 (84%), Gaps = 2/237 (0%)
Strand = Plus / Minus
Query: 261 gacggggcggtcggccatgttgcagcgcttggggatggtaatggcgacctccggcttgat 320
||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |||||
Sbjct: 249 gacggggcggtcggcnatgttgcagcgcttggggatggtgatggcgac-tccggnttgat 191
Query: 321 cccggcagccctggcggtgccggacagcatgacggcgcacaggcagctggggctctgccc 380
|||||| ||||||| ||| || || || |||||| ||||||||||||| |||||||
Sbjct: 190 cccggcgaccctggccgtgttnganagnatcacggcgnacaggcagctgggn-tctgccc 132
Query: 381 gatggtgtgcacagcggagcagcagctgctggtcggcgtggactgcgggtcgtcggcagc 440
|||||||||||| || |||||||||||||| | ||| | |||||||||||||| || ||
Sbjct: 131 gatggtgtgcaccgccgagcagcagctgctcgacggngccgactgcgggtcgtccgccgc 72
Query: 441 cgagatgcatggcgccatccttagcgccaccctgtcggcggaggctctcccgcactc 497
||| | ||| ||||||| || |||||||||| ||||||||| | ||||||||||
Sbjct: 71 cgacacgcacggcgccagccgcagcgccacccggtcggcggacnccntcccgcactc 15
>dbj|AK110485.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-B02, full
insert sequence
Length = 3096
Score = 188 bits (95), Expect = 2e-045
Identities = 134/147 (91%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 2795 ggcagagtgtaatctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttg 2736
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| ||||||||||| |||||||||||||| ||||| |||| ||||||||||
Sbjct: 2735 gggatggtgatggcgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatg 2676
Query: 352 acggcgcacaggcagctggggctctgc 378
|||||||| ||||| |||||||||||
Sbjct: 2675 acggcgcagaggcacttggggctctgc 2649
>gb|CA756111.1|CA756111 BR030035000_PLATE_C06_43_040.ab1 OA Oryza sativa (japonica
cultivar-group) cDNA clone
BR030035000_PLATE_C06_43_040.ab1 similar to NP_568160.1|
(NM_120678) putative protein [Arabidopsis thaliana]
gi|21592534|gb|AAM64483.1| (AY086919) unknown
[Arabidopsis thaliana], mRNA sequence
Length = 628
Score = 186 bits (94), Expect = 8e-045
Identities = 147/164 (89%), Gaps = 3/164 (1%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 435 ggcagagtgtaatctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttg 376
Query: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351
|||||||| ||||||||||| ||||||||||| || ||||| |||| ||||||||||
Sbjct: 375 gggatggtgatggcgacctcgggcttgatccccgcgttcctggtcgtgctggacagcatg 316
Query: 352 acggcgcacaggcagctggggctctg---cccgatggtgtgcac 392
|||||||| ||||| |||||||||| |||||||||||||||
Sbjct: 315 acggcgcagaggcacttggggctctgcttcccgatggtgtgcac 272
>emb|AL606451.1|OSJN00006 Oryza sativa (japonica cultivar-group) chromosome 4 clone OJ1217_H10,
*** SEQUENCING IN PROGRESS ***
Length = 84487
Score = 176 bits (89), Expect = 8e-042
Identities = 136/151 (90%), Gaps = 3/151 (1%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 83498 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 83439
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
||||||| |||||||||||||| ||||| |||| |||||||||||||||||| ||||
Sbjct: 83438 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 83379
Query: 365 agctggggctctg---cccgatggtgtgcac 392
| |||||||||| |||||||||||||||
Sbjct: 83378 acttggggctctgcttcccgatggtgtgcac 83348
>gb|AACV01009713.1| Oryza sativa (japonica cultivar-group) chromosome 4 Ctg009713, whole
genome shotgun sequence
Length = 19998
Score = 176 bits (89), Expect = 8e-042
Identities = 136/151 (90%), Gaps = 3/151 (1%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 3974 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 3915
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
||||||| |||||||||||||| ||||| |||| |||||||||||||||||| ||||
Sbjct: 3914 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 3855
Query: 365 agctggggctctg---cccgatggtgtgcac 392
| |||||||||| |||||||||||||||
Sbjct: 3854 acttggggctctgcttcccgatggtgtgcac 3824
Score = 103 bits (52), Expect = 9e-020
Identities = 105/120 (87%), Gaps = 2/120 (1%)
Strand = Plus / Minus
Query: 247 ccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcg 306
||||||||||||||||||||||||| ||| | |||||||||||||||||||| |||||
Sbjct: 7680 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 7621
Query: 307 acctccggcttgatcccggcagc-cctggcggtgccggacagcatgacggcgcacaggca 365
||||||||||||| |||| ||| ||| |||||| |||||||| ||||||||||||||
Sbjct: 7620 acctccggcttgacgccgg-agcgcctcacggtgctggacagcagcacggcgcacaggca 7562
>ref|NT_107198.1| Oryza sativa (japonica cultivar-group)
Length = 632744
Score = 176 bits (89), Expect = 8e-042
Identities = 136/151 (90%), Gaps = 3/151 (1%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 283504 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 283445
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
||||||| |||||||||||||| ||||| |||| |||||||||||||||||| ||||
Sbjct: 283444 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 283385
Query: 365 agctggggctctg---cccgatggtgtgcac 392
| |||||||||| |||||||||||||||
Sbjct: 283384 acttggggctctgcttcccgatggtgtgcac 283354
Score = 103 bits (52), Expect = 9e-020
Identities = 105/120 (87%), Gaps = 2/120 (1%)
Strand = Plus / Minus
Query: 247 ccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcg 306
||||||||||||||||||||||||| ||| | |||||||||||||||||||| |||||
Sbjct: 287211 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 287152
Query: 307 acctccggcttgatcccggcagc-cctggcggtgccggacagcatgacggcgcacaggca 365
||||||||||||| |||| ||| ||| |||||| |||||||| ||||||||||||||
Sbjct: 287151 acctccggcttgacgccgg-agcgcctcacggtgctggacagcagcacggcgcacaggca 287093
>gb|CH401189.1| Oryza sativa (japonica cultivar-group) chromosome 4 scaffold000026 genomic
scaffold, whole genome shotgun sequence
Length = 11796637
Score = 176 bits (89), Expect = 8e-042
Identities = 136/151 (90%), Gaps = 3/151 (1%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 10341460 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 10341401
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
||||||| |||||||||||||| ||||| |||| |||||||||||||||||| ||||
Sbjct: 10341400 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 10341341
Query: 365 agctggggctctg---cccgatggtgtgcac 392
| |||||||||| |||||||||||||||
Sbjct: 10341340 acttggggctctgcttcccgatggtgtgcac 10341310
Score = 103 bits (52), Expect = 9e-020
Identities = 105/120 (87%), Gaps = 2/120 (1%)
Strand = Plus / Minus
Query: 247 ccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcg 306
||||||||||||||||||||||||| ||| | |||||||||||||||||||| |||||
Sbjct: 10345166 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 10345107
Query: 307 acctccggcttgatcccggcagc-cctggcggtgccggacagcatgacggcgcacaggca 365
||||||||||||| |||| ||| ||| |||||| |||||||| ||||||||||||||
Sbjct: 10345106 acctccggcttgacgccgg-agcgcctcacggtgctggacagcagcacggcgcacaggca 10345048
>gb|CM000141.1| Oryza sativa (japonica cultivar-group) chromosome 4, whole genome shotgun
sequence
Length = 32311234
Score = 176 bits (89), Expect = 8e-042
Identities = 136/151 (90%), Gaps = 3/151 (1%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 17688822 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 17688763
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
||||||| |||||||||||||| ||||| |||| |||||||||||||||||| ||||
Sbjct: 17688762 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 17688703
Query: 365 agctggggctctg---cccgatggtgtgcac 392
| |||||||||| |||||||||||||||
Sbjct: 17688702 acttggggctctgcttcccgatggtgtgcac 17688672
Score = 103 bits (52), Expect = 9e-020
Identities = 105/120 (87%), Gaps = 2/120 (1%)
Strand = Plus / Minus
Query: 247 ccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcg 306
||||||||||||||||||||||||| ||| | |||||||||||||||||||| |||||
Sbjct: 17692528 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 17692469
Query: 307 acctccggcttgatcccggcagc-cctggcggtgccggacagcatgacggcgcacaggca 365
||||||||||||| |||| ||| ||| |||||| |||||||| ||||||||||||||
Sbjct: 17692468 acctccggcttgacgccgg-agcgcctcacggtgctggacagcagcacggcgcacaggca 17692410
>emb|AL606453.2|OSJN00010 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ991214_12,
complete sequence
Length = 116952
Score = 176 bits (89), Expect = 8e-042
Identities = 136/151 (90%), Gaps = 3/151 (1%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 63499 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 63440
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
||||||| |||||||||||||| ||||| |||| |||||||||||||||||| ||||
Sbjct: 63439 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 63380
Query: 365 agctggggctctg---cccgatggtgtgcac 392
| |||||||||| |||||||||||||||
Sbjct: 63379 acttggggctctgcttcccgatggtgtgcac 63349
Score = 103 bits (52), Expect = 9e-020
Identities = 105/120 (87%), Gaps = 2/120 (1%)
Strand = Plus / Minus
Query: 247 ccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcg 306
||||||||||||||||||||||||| ||| | |||||||||||||||||||| |||||
Sbjct: 67206 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 67147
Query: 307 acctccggcttgatcccggcagc-cctggcggtgccggacagcatgacggcgcacaggca 365
||||||||||||| |||| ||| ||| |||||| |||||||| ||||||||||||||
Sbjct: 67146 acctccggcttgacgccgg-agcgcctcacggtgctggacagcagcacggcgcacaggca 67088
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
sequence
Length = 35498469
Score = 176 bits (89), Expect = 8e-042
Identities = 136/151 (90%), Gaps = 3/151 (1%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 20552871 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 20552812
Query: 305 cgacctccggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggc 364
||||||| |||||||||||||| ||||| |||| |||||||||||||||||| ||||
Sbjct: 20552811 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 20552752
Query: 365 agctggggctctg---cccgatggtgtgcac 392
| |||||||||| |||||||||||||||
Sbjct: 20552751 acttggggctctgcttcccgatggtgtgcac 20552721
Score = 103 bits (52), Expect = 9e-020
Identities = 105/120 (87%), Gaps = 2/120 (1%)
Strand = Plus / Minus
Query: 247 ccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcg 306
||||||||||||||||||||||||| ||| | |||||||||||||||||||| |||||
Sbjct: 20556578 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 20556519
Query: 307 acctccggcttgatcccggcagc-cctggcggtgccggacagcatgacggcgcacaggca 365
||||||||||||| |||| ||| ||| |||||| |||||||| ||||||||||||||
Sbjct: 20556518 acctccggcttgacgccgg-agcgcctcacggtgctggacagcagcacggcgcacaggca 20556460
>gb|AU184823.1|AU184823 AU184823 Rice cDNA from young root Oryza sativa (japonica
cultivar-group) cDNA clone R10250, mRNA sequence
Length = 362
Score = 174 bits (88), Expect = 3e-041
Identities = 132/144 (91%), Gaps = 3/144 (2%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 144 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgnagcgcttg 85
Query: 292 gggatggtaatggcgacctccggcttgatcccggc-agccctgg-cggtgccggaca-gc 348
|||||||| ||||||||| |||||||||||||||| | |||||| | ||| ||||| ||
Sbjct: 84 gggatggtgatggcgaccnccggcttgatcccggcganccctggcccgtgttggacatgc 25
Query: 349 atgacggcgcacaggcagctgggg 372
|| ||||| |||||||||||||||
Sbjct: 24 atcacggcncacaggcagctgggg 1
>gb|C99089.1|C99089 C99089 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E4433_2Z, mRNA sequence
Length = 349
Score = 161 bits (81), Expect = 5e-037
Identities = 93/96 (96%), Gaps = 1/96 (1%)
Strand = Plus / Minus
Query: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 101 ggcagcgtgtaatcnccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 42
Query: 292 gggatggtaatggcgacctcc-ggcttgatcccggc 326
|||||||| |||||||||||| ||||||||||||||
Sbjct: 41 gggatggtgatggcgacctccgggcttgatcccggc 6
>gb|AU064186.1|AU064186 AU064186 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E4182_1A, mRNA sequence
Length = 319
Score = 135 bits (68), Expect = 3e-029
Identities = 133/154 (86%), Gaps = 1/154 (0%)
Strand = Plus / Minus
Query: 344 acagcatgacggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagcagc 403
||||||| |||||||| ||||||||||| |||||||||||||||||||| || |||||||
Sbjct: 319 acagcatcacggcgcanaggcagctggg-ctctgcccgatggtgtgcaccgccgagcagc 261
Query: 404 agctgctggtcggcgtggactgcgggtcgtcggcagccgagatgcatggcgccatcctta 463
||||||| | ||||| |||||||||||||| || ||||| | ||| ||||||| || |
Sbjct: 260 agctgctcgacggcgccgactgcgggtcgtccgccgccgacacgcacggcgccagccgca 201
Query: 464 gcgccaccctgtcggcggaggctctcccgcactc 497
||||||||| ||||||||| | |||||||||||
Sbjct: 200 gcgccacccggtcggcggacnccctcccgcactc 167
>gb|CV721235.1|CV721235 YBH--03-G09.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--03-G09, mRNA sequence
Length = 454
Score = 119 bits (60), Expect = 2e-024
Identities = 119/136 (87%), Gaps = 2/136 (1%)
Strand = Plus / Minus
Query: 231 gggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgctt 290
||||||||||||| | ||||||||||||||||||||||||| ||| | |||||||||||
Sbjct: 415 gggcagcgtgtaagcgccgcacttgtagccgacggggcggttggcgagtttgcagcgctt 356
Query: 291 ggggatggtaatggcgacctccggcttgatcccggcagc-cctggcggtgccggacagca 349
||||||||| ||||| ||||||||||||| |||| ||| ||| |||||| ||||||||
Sbjct: 355 ggggatggtgatggccacctccggcttgacgccgg-agcgcctcacggtgctggacagca 297
Query: 350 tgacggcgcacaggca 365
||||||||||||||
Sbjct: 296 gcacggcgcacaggca 281
>gb|CV721634.1|CV721634 YBH--04-M15.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--04-M15, mRNA sequence
Length = 450
Score = 119 bits (60), Expect = 2e-024
Identities = 119/136 (87%), Gaps = 2/136 (1%)
Strand = Plus / Minus
Query: 231 gggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgctt 290
||||||||||||| | ||||||||||||||||||||||||| ||| | |||||||||||
Sbjct: 427 gggcagcgtgtaagcgccgcacttgtagccgacggggcggttggcgagtttgcagcgctt 368
Query: 291 ggggatggtaatggcgacctccggcttgatcccggcagc-cctggcggtgccggacagca 349
||||||||| ||||| ||||||||||||| |||| ||| ||| |||||| ||||||||
Sbjct: 367 ggggatggtgatggccacctccggcttgacgccgg-agcgcctcacggtgctggacagca 309
Query: 350 tgacggcgcacaggca 365
||||||||||||||
Sbjct: 308 gcacggcgcacaggca 293
>ref|XM_472425.1| Oryza sativa (japonica cultivar-group), predicted mRNA
Length = 372
Score = 119 bits (60), Expect = 2e-024
Identities = 119/136 (87%), Gaps = 2/136 (1%)
Strand = Plus / Minus
Query: 231 gggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgctt 290
||||||||||||| | ||||||||||||||||||||||||| ||| | |||||||||||
Sbjct: 357 gggcagcgtgtaagcgccgcacttgtagccgacggggcggttggcgagtttgcagcgctt 298
Query: 291 ggggatggtaatggcgacctccggcttgatcccggcagc-cctggcggtgccggacagca 349
||||||||| ||||| ||||||||||||| |||| ||| ||| |||||| ||||||||
Sbjct: 297 ggggatggtgatggccacctccggcttgacgccgg-agcgcctcacggtgctggacagca 239
Query: 350 tgacggcgcacaggca 365
||||||||||||||
Sbjct: 238 gcacggcgcacaggca 223
>gb|D24434.1|D24434 RICR1885A Rice root Oryza sativa (japonica cultivar-group) cDNA
clone R1885_2A, mRNA sequence
Length = 337
Score = 103 bits (52), Expect = 9e-020
Identities = 129/156 (82%), Gaps = 1/156 (0%)
Strand = Plus / Minus
Query: 342 ggacagcatgacggcgcacaggcagctggggctctgcccgatggtgtgcacagcggagca 401
||||||||| |||||| ||||||||||||| | |||||||||||||| || | |||||
Sbjct: 317 ggacagcatcacggcgnacaggcagctgggn-tntgcccgatggtgtgnaccgncgagca 259
Query: 402 gcagctgctggtcggcgtggactgcgggtcgtcggcagccgagatgcatggcgccatcct 461
||||||||| | ||||| || ||||||||||| | ||||| | ||| ||||||| ||
Sbjct: 258 gcagctgctcgacggcgccgantgcgggtcgtccgncgccgaaacgcacggcgccagccg 199
Query: 462 tagcgccaccctgtcggcggaggctctcccgcactc 497
||||||| || ||||||||| || |||||||||||
Sbjct: 198 cagcgccanccggtcggcggacgccctcccgcactc 163
>gb|CV720933.1|CV720933 YBH--02-F09.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--02-F09, mRNA sequence
Length = 452
Score = 103 bits (52), Expect = 9e-020
Identities = 76/84 (90%)
Strand = Plus / Minus
Query: 236 gcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttgggga 295
|||||||| | ||||||||||||||||||||||||| ||| | ||||||||||||||||
Sbjct: 452 gcgtgtaagcgccgcacttgtagccgacggggcggttggcgagtttgcagcgcttgggga 393
Query: 296 tggtaatggcgacctccggcttga 319
|||| ||||| |||||||||||||
Sbjct: 392 tggtgatggccacctccggcttga 369
>gb|CV721396.1|CV721396 YBH--03-P10.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--03-P10, mRNA sequence
Length = 453
Score = 103 bits (52), Expect = 9e-020
Identities = 105/120 (87%), Gaps = 2/120 (1%)
Strand = Plus / Minus
Query: 247 ccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcg 306
||||||||||||||||||||||||| ||| | |||||||||||||||||||| |||||
Sbjct: 407 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 348
Query: 307 acctccggcttgatcccggcagc-cctggcggtgccggacagcatgacggcgcacaggca 365
||||||||||||| |||| ||| ||| |||||| |||||||| ||||||||||||||
Sbjct: 347 acctccggcttgacgccgg-agcgcctcacggtgctggacagcagcacggcgcacaggca 289
>gb|C73730.1|C73730 C73730 Rice panicle (longer than 10cm) Oryza sativa (japonica
cultivar-group) cDNA clone E20278_2A, mRNA sequence
Length = 311
Score = 89.7 bits (45), Expect = 1e-015
Identities = 106/128 (82%)
Strand = Plus / Minus
Query: 370 gggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggactgcggg 429
||||||||||||||| ||||||| || |||||||||||||| | ||| | |||||| ||
Sbjct: 307 gggctctgcccgatgttgtgcaccgccgagcagcagctgctcgacggngccgactgcngg 248
Query: 430 tcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggaggctctc 489
||||| || ||||| | ||| ||||||| || |||||||||| ||||||||| |||
Sbjct: 247 tcgtccgccgccganacgcacggcgccagccgcagcgccacccggtcggcggacnncctc 188
Query: 490 ccgcactc 497
||||||||
Sbjct: 187 ccgcactc 180
>gb|AU064024.1|AU064024 AU064024 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E3418_1A, mRNA sequence
Length = 301
Score = 85.7 bits (43), Expect = 2e-014
Identities = 105/127 (82%)
Strand = Plus / Minus
Query: 370 gggctctgcccgatggtgtgcacagcggagcagcagctgctggtcggcgtggactgcggg 429
||||| ||||||||||||||||| || ||| |||||||||| | ||| |||||||||
Sbjct: 295 gggctttgcccgatggtgtgcaccgccgagnagcagctgcttgacggnnccgactgcggg 236
Query: 430 tcgtcggcagccgagatgcatggcgccatccttagcgccaccctgtcggcggaggctctc 489
||||| || ||||| | ||| ||||||| || ||||||| || ||||||||| || |||
Sbjct: 235 tcgtccgccgccgaaangcacggcgccagccgcagcgccaaccggtcggcggacgccctc 176
Query: 490 ccgcact 496
|||||||
Sbjct: 175 ccgcact 169
>gb|CV721349.1|CV721349 YBH--03-M13.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--03-M13, mRNA sequence
Length = 433
Score = 85.7 bits (43), Expect = 2e-014
Identities = 118/138 (85%), Gaps = 4/138 (2%)
Strand = Plus / Plus
Query: 231 gggcagcgtgtaatctccgcacttgtagccgac-ggggcggtcggccatgttgcagcgct 289
||||||||||||| | ||||||||||||||||| |||||||| ||| | ||||||||||
Sbjct: 284 gggcagcgtgtaagcgccgcacttgtagccgacgggggcggttggcgagtttgcagcgct 343
Query: 290 tggggat-ggtaatggcgacctccggcttgatcccggcagc-cctggcggtgccggacag 347
||||||| || ||||| ||||||||||||| |||| ||| ||| |||||| ||||||
Sbjct: 344 tggggatgggggatggccacctccggcttgacgccgg-agcgcctcacggtgctggacag 402
Query: 348 catgacggcgcacaggca 365
|| ||||||||||||||
Sbjct: 403 cancacggcgcacaggca 420
>gb|CV721865.1|CV721865 YBH--05-J14.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--05-J14, mRNA sequence
Length = 392
Score = 73.8 bits (37), Expect = 8e-011
Identities = 90/105 (85%), Gaps = 2/105 (1%)
Strand = Plus / Minus
Query: 262 acggggcggtcggccatgttgcagcgcttggggatggtaatggcgacctccggcttgatc 321
|||||||||| ||| | |||||||||||||||||||| ||||| |||||||||||||
Sbjct: 392 acggggcggttggcgagtttgcagcgcttggggatggtgatggccacctccggcttgacg 333
Query: 322 ccggcagc-cctggcggtgccggacagcatgacggcgcacaggca 365
|||| ||| ||| |||||| |||||||| ||||||||||||||
Sbjct: 332 ccgg-agcgcctcacggtgctggacagcagcacggcgcacaggca 289
>dbj|AK062916.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-H02, full
insert sequence
Length = 590
Score = 63.9 bits (32), Expect = 8e-008
Identities = 107/132 (81%)
Strand = Plus / Minus
Query: 253 ttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcgacctcc 312
||||| |||| |||||||| ||| ||| |||||||||||||||||| ||||| || |
Sbjct: 407 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 348
Query: 313 ggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggcagctgggg 372
||||||| ||||| || |||||| ||||||||||||||||||||||| |||||
Sbjct: 347 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 288
Query: 373 ctctgcccgatg 384
|| ||||||||
Sbjct: 287 ttccgcccgatg 276
>dbj|AK105208.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-H09, full
insert sequence
Length = 702
Score = 63.9 bits (32), Expect = 8e-008
Identities = 107/132 (81%)
Strand = Plus / Minus
Query: 253 ttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcgacctcc 312
||||| |||| |||||||| ||| ||| |||||||||||||||||| ||||| || |
Sbjct: 407 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 348
Query: 313 ggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggcagctgggg 372
||||||| ||||| || |||||| ||||||||||||||||||||||| |||||
Sbjct: 347 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 288
Query: 373 ctctgcccgatg 384
|| ||||||||
Sbjct: 287 ttccgcccgatg 276
>dbj|BA000010.8| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
sequence
Length = 43342410
Score = 63.9 bits (32), Expect = 8e-008
Identities = 107/132 (81%)
Strand = Plus / Plus
Query: 253 ttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcgacctcc 312
||||| |||| |||||||| ||| ||| |||||||||||||||||| ||||| || |
Sbjct: 36558341 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 36558400
Query: 313 ggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggcagctgggg 372
||||||| ||||| || |||||| ||||||||||||||||||||||| |||||
Sbjct: 36558401 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 36558460
Query: 373 ctctgcccgatg 384
|| ||||||||
Sbjct: 36558461 ttccgcccgatg 36558472
>ref|NT_079927.2| Oryza sativa (japonica cultivar-group)
Length = 14818989
Score = 63.9 bits (32), Expect = 8e-008
Identities = 107/132 (81%)
Strand = Plus / Plus
Query: 253 ttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcgacctcc 312
||||| |||| |||||||| ||| ||| |||||||||||||||||| ||||| || |
Sbjct: 11005724 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 11005783
Query: 313 ggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggcagctgggg 372
||||||| ||||| || |||||| ||||||||||||||||||||||| |||||
Sbjct: 11005784 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 11005843
Query: 373 ctctgcccgatg 384
|| ||||||||
Sbjct: 11005844 ttccgcccgatg 11005855
>dbj|AP004127.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
clone:P0005H10
Length = 142885
Score = 63.9 bits (32), Expect = 8e-008
Identities = 107/132 (81%)
Strand = Plus / Plus
Query: 253 ttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcgacctcc 312
||||| |||| |||||||| ||| ||| |||||||||||||||||| ||||| || |
Sbjct: 129510 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 129569
Query: 313 ggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggcagctgggg 372
||||||| ||||| || |||||| ||||||||||||||||||||||| |||||
Sbjct: 129570 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 129629
Query: 373 ctctgcccgatg 384
|| ||||||||
Sbjct: 129630 ttccgcccgatg 129641
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
sequence
Length = 43261740
Score = 63.9 bits (32), Expect = 8e-008
Identities = 107/132 (81%)
Strand = Plus / Plus
Query: 253 ttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatggcgacctcc 312
||||| |||| |||||||| ||| ||| |||||||||||||||||| ||||| || |
Sbjct: 36477671 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 36477730
Query: 313 ggcttgatcccggcagccctggcggtgccggacagcatgacggcgcacaggcagctgggg 372
||||||| ||||| || |||||| ||||||||||||||||||||||| |||||
Sbjct: 36477731 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 36477790
Query: 373 ctctgcccgatg 384
|| ||||||||
Sbjct: 36477791 ttccgcccgatg 36477802
Database: Oryza_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:41 PM
Number of letters in database: 2,800,419,916
Number of sequences in database: 438,736
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 644,334
Number of Sequences: 438736
Number of extensions: 644334
Number of successful extensions: 17203
Number of sequences better than 0.5: 56
Number of HSP's better than 0.5 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16676
Number of HSP's gapped (non-prelim): 508
length of query: 531
length of database: 2,800,419,916
effective HSP length: 21
effective length of query: 510
effective length of database: 2,791,206,460
effective search space: 1423515294600
effective search space used: 1423515294600
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)