BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCF7a10.yg.2.1
(523 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW774471.1|AW774471 EST333622 KV3 Medicago truncatula cD... 76 3e-012
gb|BE942980.1|BE942980 EST422559 MGHG Medicago truncatula c... 76 3e-012
gb|BI308597.1|BI308597 EST530007 GPOD Medicago truncatula c... 76 3e-012
gb|DW018960.1|DW018960 EST1227921 MTY Medicago truncatula c... 76 3e-012
gb|AW574031.1|AW574031 EST316622 GVN Medicago truncatula cD... 54 1e-005
gb|BF646657.1|BF646657 NF076H12EC1F1103 Elicited cell cultu... 54 1e-005
gb|AW686486.2|AW686486 NF041H10NR1F1000 Nodulated root Medi... 54 1e-005
gb|DW016466.1|DW016466 EST1225427 MTY Medicago truncatula c... 44 0.012
gb|AW691884.1|AW691884 NF045B08ST1F1000 Developing stem Med... 42 0.046
gb|AW695791.1|AW695791 NF098F03ST1F1029 Developing stem Med... 42 0.046
gb|AW697303.1|AW697303 NF115B10ST1F1080 Developing stem Med... 42 0.046
gb|BE321417.1|BE321417 NF024H12IN1F1096 Insect herbivory Me... 42 0.046
gb|BE204599.1|BE204599 EST397275 KV0 Medicago truncatula cD... 42 0.046
gb|BG582283.1|BG582283 EST484024 GVN Medicago truncatula cD... 42 0.046
gb|BI271915.1|BI271915 NF016C03FL1F1021 Developing flower M... 42 0.046
gb|BI272466.1|BI272466 NF021H08FL1F1075 Developing flower M... 42 0.046
gb|CX527137.1|CX527137 s13dNF40D04AT042_514786 Aphid-Infect... 42 0.046
gb|CX527706.1|CX527706 s13dNF38E01AT006_515924 Aphid-Infect... 42 0.046
gb|AC161863.20| Medicago truncatula clone mth2-175f4, compl... 42 0.046
>gb|AW774471.1|AW774471 EST333622 KV3 Medicago truncatula cDNA clone pKV3-22N3, mRNA
sequence
Length = 646
Score = 75.8 bits (38), Expect = 3e-012
Identities = 42/44 (95%)
Strand = Plus / Plus
Query: 463 tttgatgctgtgatgcactttgcagctgnngcttatgtgggaga 506
|||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 281 tttgatgctgtgatgcactttgcagctgttgcttatgtgggaga 324
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 213 tatcgagttaccattgtggataatctatctagaggaaatatgggagcagtaaaggttctg 272
|||||||||||||| ||||||||||| || | |||||| |||| || || | ||||||
Sbjct: 128 tatcgagttaccatagtggataatctgtcacgtggaaatttgggtgctgtcagggttctt 187
Query: 273 cagggcttatttccgcagcctggtagactacaatt 307
|| |||||||||| || ||||| ||||| |||||
Sbjct: 188 caaagcttatttccacaacctggaagacttcaatt 222
>gb|BE942980.1|BE942980 EST422559 MGHG Medicago truncatula cDNA clone pMGHG-14M15, mRNA
sequence
Length = 461
Score = 75.8 bits (38), Expect = 3e-012
Identities = 42/44 (95%)
Strand = Plus / Plus
Query: 463 tttgatgctgtgatgcactttgcagctgnngcttatgtgggaga 506
|||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 207 tttgatgctgtgatgcactttgcagctgttgcttatgtgggaga 250
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 213 tatcgagttaccattgtggataatctatctagaggaaatatgggagcagtaaaggttctg 272
|||||||||||||| ||||||||||| || | |||||| |||| || || | ||||||
Sbjct: 54 tatcgagttaccatagtggataatctgtcacgtggaaatttgggtgctgtcagggttctt 113
Query: 273 cagggcttatttccgcagcctggtagactacaatt 307
|| |||||||||| || ||||| ||||| |||||
Sbjct: 114 caaagcttatttccacaacctggaagacttcaatt 148
>gb|BI308597.1|BI308597 EST530007 GPOD Medicago truncatula cDNA clone pGPOD-7G10 5' end,
mRNA sequence
Length = 698
Score = 75.8 bits (38), Expect = 3e-012
Identities = 42/44 (95%)
Strand = Plus / Plus
Query: 463 tttgatgctgtgatgcactttgcagctgnngcttatgtgggaga 506
|||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 606 tttgatgctgtgatgcactttgcagctgttgcttatgtgggaga 649
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 213 tatcgagttaccattgtggataatctatctagaggaaatatgggagcagtaaaggttctg 272
|||||||||||||| ||||||||||| || | |||||| |||| || || | ||||||
Sbjct: 453 tatcgagttaccatagtggataatctgtcacgtggaaatttgggtgctgtcagggttctt 512
Query: 273 cagggcttatttccgcagcctggtagactacaatt 307
|| |||||||||| || ||||| ||||| |||||
Sbjct: 513 caaagcttatttccacaacctggaagacttcaatt 547
>gb|DW018960.1|DW018960 EST1227921 MTY Medicago truncatula cDNA clone MTYBD07, mRNA
sequence
Length = 741
Score = 75.8 bits (38), Expect = 3e-012
Identities = 42/44 (95%)
Strand = Plus / Plus
Query: 463 tttgatgctgtgatgcactttgcagctgnngcttatgtgggaga 506
|||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 672 tttgatgctgtgatgcactttgcagctgttgcttatgtgggaga 715
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 213 tatcgagttaccattgtggataatctatctagaggaaatatgggagcagtaaaggttctg 272
|||||||||||||| ||||||||||| || | |||||| |||| || || | ||||||
Sbjct: 519 tatcgagttaccatagtggataatctgtcacgtggaaatttgggtgctgtcagggttctt 578
Query: 273 cagggcttatttccgcagcctggtagactacaatt 307
|| |||||||||| || ||||| ||||| |||||
Sbjct: 579 caaagcttatttccacaacctggaagacttcaatt 613
>gb|AW574031.1|AW574031 EST316622 GVN Medicago truncatula cDNA clone pGVN-50L10, mRNA
sequence
Length = 699
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 213 tatcgagttaccattgtggataatctatctagaggaaatatgggagcagtaaaggttctg 272
|||||||||||||| ||||||||||| || | |||||| |||| || || | ||||||
Sbjct: 539 tatcgagttaccatagtggataatctgtcacgtggaaatttgggtgctgtcagggttctt 598
Query: 273 cagggcttatttccgcagcctggtagactacaatt 307
|| |||||||||| || ||||| ||||| |||||
Sbjct: 599 caaagcttatttccacaacctggaagacttcaatt 633
>gb|BF646657.1|BF646657 NF076H12EC1F1103 Elicited cell culture Medicago truncatula cDNA
clone NF076H12EC 5', mRNA sequence
Length = 562
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 213 tatcgagttaccattgtggataatctatctagaggaaatatgggagcagtaaaggttctg 272
|||||||||||||| ||||||||||| || | |||||| |||| || || | ||||||
Sbjct: 442 tatcgagttaccatagtggataatctgtcacgtggaaatttgggtgctgtcagggttctt 501
Query: 273 cagggcttatttccgcagcctggtagactacaatt 307
|| |||||||||| || ||||| ||||| |||||
Sbjct: 502 caaagcttatttccacaacctggaagacttcaatt 536
>gb|AW686486.2|AW686486 NF041H10NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF041H10NR 5', mRNA sequence
Length = 561
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 213 tatcgagttaccattgtggataatctatctagaggaaatatgggagcagtaaaggttctg 272
|||||||||||||| ||||||||||| || | |||||| |||| || || | ||||||
Sbjct: 383 tatcgagttaccatagtggataatctgtcacgtggaaatttgggtgctgtcagggttctt 442
Query: 273 cagggcttatttccgcagcctggtagactacaatt 307
|| |||||||||| || ||||| ||||| |||||
Sbjct: 443 caaagcttatttccacaacctggaagacttcaatt 477
Score = 44.1 bits (22), Expect = 0.012
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 463 tttgatgctgtgatgcactttg 484
||||||||||||||||||||||
Sbjct: 540 tttgatgctgtgatgcactttg 561
>gb|DW016466.1|DW016466 EST1225427 MTY Medicago truncatula cDNA clone MTYAH55, mRNA
sequence
Length = 574
Score = 44.1 bits (22), Expect = 0.012
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 213 tatcgagttaccattgtggataatct 238
|||||||||||||| |||||||||||
Sbjct: 524 tatcgagttaccatagtggataatct 549
>gb|AW691884.1|AW691884 NF045B08ST1F1000 Developing stem Medicago truncatula cDNA clone
NF045B08ST 5', mRNA sequence
Length = 660
Score = 42.1 bits (21), Expect = 0.046
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 462 atttgatgctgtgatgcactttgcagctg 490
||||||||| |||||||||||||| ||||
Sbjct: 605 atttgatgccgtgatgcactttgctgctg 633
Score = 42.1 bits (21), Expect = 0.046
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 129 gaacctggtgttacccacgtcttagtaacaggaggagctggttatattggttcacatgcc 188
|||||||| || || ||||| ||||||||||| || || || |||||||| || |||||
Sbjct: 368 gaacctggggtcactcacgttttagtaacagggggtgcaggctatattggctcgcatgct 427
Query: 189 gcttt 193
|||||
Sbjct: 428 gcttt 432
>gb|AW695791.1|AW695791 NF098F03ST1F1029 Developing stem Medicago truncatula cDNA clone
NF098F03ST 5', mRNA sequence
Length = 660
Score = 42.1 bits (21), Expect = 0.046
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 462 atttgatgctgtgatgcactttgcagctg 490
||||||||| |||||||||||||| ||||
Sbjct: 36 atttgatgccgtgatgcactttgctgctg 64
>gb|AW697303.1|AW697303 NF115B10ST1F1080 Developing stem Medicago truncatula cDNA clone
NF115B10ST 5', mRNA sequence
Length = 653
Score = 42.1 bits (21), Expect = 0.046
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 462 atttgatgctgtgatgcactttgcagctg 490
||||||||| |||||||||||||| ||||
Sbjct: 478 atttgatgccgtgatgcactttgctgctg 506
Score = 42.1 bits (21), Expect = 0.046
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 129 gaacctggtgttacccacgtcttagtaacaggaggagctggttatattggttcacatgcc 188
|||||||| || || ||||| ||||||||||| || || || |||||||| || |||||
Sbjct: 136 gaacctggggtcactcacgttttagtaacagggggtgcaggctatattggctcgcatgct 195
Query: 189 gcttt 193
|||||
Sbjct: 196 gcttt 200
>gb|BE321417.1|BE321417 NF024H12IN1F1096 Insect herbivory Medicago truncatula cDNA clone
NF024H12IN 5', mRNA sequence
Length = 644
Score = 42.1 bits (21), Expect = 0.046
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 129 gaacctggtgttacccacgtcttagtaacaggaggagctggttatattggttcacatgcc 188
|||||||| || || ||||| ||||||||||| || || || |||||||| || |||||
Sbjct: 458 gaacctggggtcactcacgttttagtaacagggggtgcaggctatattggctcgcatgct 517
Query: 189 gcttt 193
|||||
Sbjct: 518 gcttt 522
>gb|BE204599.1|BE204599 EST397275 KV0 Medicago truncatula cDNA clone pKV0-16F14, mRNA
sequence
Length = 525
Score = 42.1 bits (21), Expect = 0.046
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 129 gaacctggtgttacccacgtcttagtaacaggaggagctggttatattggttcacatgcc 188
|||||||| || || ||||| ||||||||||| || || || |||||||| || |||||
Sbjct: 343 gaacctggggtcactcacgttttagtaacagggggtgcaggctatattggctcgcatgct 402
Query: 189 gcttt 193
|||||
Sbjct: 403 gcttt 407
>gb|BG582283.1|BG582283 EST484024 GVN Medicago truncatula cDNA clone pGVN-69A4 5' end, mRNA
sequence
Length = 388
Score = 42.1 bits (21), Expect = 0.046
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 462 atttgatgctgtgatgcactttgcagctg 490
||||||||| |||||||||||||| ||||
Sbjct: 206 atttgatgccgtgatgcactttgctgctg 234
>gb|BI271915.1|BI271915 NF016C03FL1F1021 Developing flower Medicago truncatula cDNA clone
NF016C03FL 5', mRNA sequence
Length = 364
Score = 42.1 bits (21), Expect = 0.046
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 462 atttgatgctgtgatgcactttgcagctg 490
||||||||| |||||||||||||| ||||
Sbjct: 172 atttgatgccgtgatgcactttgctgctg 200
>gb|BI272466.1|BI272466 NF021H08FL1F1075 Developing flower Medicago truncatula cDNA clone
NF021H08FL 5', mRNA sequence
Length = 713
Score = 42.1 bits (21), Expect = 0.046
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 462 atttgatgctgtgatgcactttgcagctg 490
||||||||| |||||||||||||| ||||
Sbjct: 303 atttgatgccgtgatgcactttgctgctg 331
>gb|CX527137.1|CX527137 s13dNF40D04AT042_514786 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 617
Score = 42.1 bits (21), Expect = 0.046
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 462 atttgatgctgtgatgcactttgcagctg 490
||||||||| |||||||||||||| ||||
Sbjct: 413 atttgatgccgtgatgcactttgctgctg 441
>gb|CX527706.1|CX527706 s13dNF38E01AT006_515924 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 552
Score = 42.1 bits (21), Expect = 0.046
Identities = 54/65 (83%)
Strand = Plus / Plus
Query: 129 gaacctggtgttacccacgtcttagtaacaggaggagctggttatattggttcacatgcc 188
|||||||| || || ||||| ||||||||||| || || || |||||||| || |||||
Sbjct: 452 gaacctggggtcactcacgttttagtaacagggggtgcaggctatattggctcgcatgct 511
Query: 189 gcttt 193
|||||
Sbjct: 512 gcttt 516
>gb|AC161863.20| Medicago truncatula clone mth2-175f4, complete sequence
Length = 116075
Score = 42.1 bits (21), Expect = 0.046
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 129 gaacctggtgttacccacgtcttagtaacaggaggagctggttatattggttcacatgcc 188
|||||||| || || ||||| ||||||||||| || || || |||||||| || |||||
Sbjct: 19647 gaacctggggtcactcacgttttagtaacagggggtgcaggctatattggctcgcatgct 19588
Query: 189 gcttt 193
|||||
Sbjct: 19587 gcttt 19583
Score = 42.1 bits (21), Expect = 0.046
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 462 atttgatgctgtgatgcactttgcagctg 490
||||||||| |||||||||||||| ||||
Sbjct: 19203 atttgatgccgtgatgcactttgctgctg 19175
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 123,329
Number of Sequences: 392609
Number of extensions: 123329
Number of successful extensions: 8711
Number of sequences better than 0.5: 19
Number of HSP's better than 0.5 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8674
Number of HSP's gapped (non-prelim): 37
length of query: 523
length of database: 441,732,993
effective HSP length: 19
effective length of query: 504
effective length of database: 434,273,422
effective search space: 218873804688
effective search space used: 218873804688
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)