BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBTB.064G21F020918.3.1
         (705 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG921512.1|CG921512  MBEEI33TFB mth2 Medicago truncatula ...    40   0.25 
gb|CX531824.1|CX531824  s13dNF82A03MJ017_257590 Methyl Jasmo...    40   0.25 

>gb|CG921512.1|CG921512 MBEEI33TFB mth2 Medicago truncatula genomic clone 38E17, DNA
           sequence
          Length = 810

 Score = 40.1 bits (20), Expect = 0.25
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 663 atgatgcctccttatgggacaccaccac 690
           ||||||||||||||||| || |||||||
Sbjct: 231 atgatgcctccttatggtactccaccac 258



>gb|CX531824.1|CX531824 s13dNF82A03MJ017_257590 Methyl Jasmonate-Elicited Root Cell
           Suspension Culture Medicago truncatula cDNA, mRNA
           sequence
          Length = 623

 Score = 40.1 bits (20), Expect = 0.25
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 663 atgatgcctccttatgggacaccaccac 690
           ||||||||||||||||| || |||||||
Sbjct: 504 atgatgcctccttatggtactccaccac 531



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 181,487
Number of Sequences: 392609
Number of extensions: 181487
Number of successful extensions: 12119
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12116
Number of HSP's gapped (non-prelim): 3
length of query: 705
length of database: 441,732,993
effective HSP length: 19
effective length of query: 686
effective length of database: 434,273,422
effective search space: 297911567492
effective search space used: 297911567492
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)