BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.060L08F020610.3.1
(677 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW695082.1|AW695082 NF091D12ST1F1101 Developing stem Med... 111 8e-023
gb|BF646871.1|BF646871 NF068B09EC1F1076 Elicited cell cultu... 111 8e-023
gb|AW693828.2|AW693828 NF069E04ST1F1034 Developing stem Med... 111 8e-023
gb|BG450081.1|BG450081 NF011E06DT1F1051 Drought Medicago tr... 111 8e-023
gb|BI308280.1|BI308280 EST529690 GPOD Medicago truncatula c... 111 8e-023
gb|BQ148260.1|BQ148260 NF065D12FL1F1102 Developing flower M... 111 8e-023
gb|AJ498016.1|AJ498016 AJ498016 MTPOSE Medicago truncatula ... 111 8e-023
gb|CB891685.1|CB891685 EST648654 KV3 Medicago truncatula cD... 111 8e-023
gb|CF068981.1|CF068981 EST669702 MTUS Medicago truncatula c... 111 8e-023
gb|CX523840.1|CX523840 s13dNF05F06AT059_440078 Aphid-Infect... 111 8e-023
gb|CX535243.1|CX535243 s13dNF37C05MJ038_388663 Methyl Jasmo... 111 8e-023
gb|AW689696.1|AW689696 NF023D01ST1F1000 Developing stem Med... 105 5e-021
gb|BF647863.1|BF647863 NF038B02EC1F1016 Elicited cell cultu... 105 5e-021
gb|AC141107.5| Medicago truncatula clone mth2-34a12, comple... 76 4e-012
gb|BI270386.1|BI270386 NF010G07FL1F1056 Developing flower M... 62 6e-008
gb|CX535093.1|CX535093 s13dNF36H09MJ080_388365 Methyl Jasmo... 60 3e-007
gb|CX542040.1|CX542040 s13dNF89D01GS014_467388 Germinating ... 50 2e-004
gb|AW685281.1|AW685281 NF027B07NR1F1000 Nodulated root Medi... 44 0.015
gb|AC161401.2| Medicago truncatula chromosome 7 clone mte1-... 42 0.060
gb|CB892038.1|CB892038 EST649007 KV3 Medicago truncatula cD... 40 0.24
>gb|AW695082.1|AW695082 NF091D12ST1F1101 Developing stem Medicago truncatula cDNA clone
NF091D12ST 5', mRNA sequence
Length = 628
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 365 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 424
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 425 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 480
>gb|BF646871.1|BF646871 NF068B09EC1F1076 Elicited cell culture Medicago truncatula cDNA
clone NF068B09EC 5', mRNA sequence
Length = 652
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 309 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 368
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 369 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 424
Score = 42.1 bits (21), Expect = 0.060
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 439 ggtgttggggtctataatcctggctactggggcatgaacattga 482
|||||||| || ||||| ||||| | |||||||||||| |||||
Sbjct: 546 ggtgttggcgtttataaccctggnttctggggcatgaatattga 589
>gb|AW693828.2|AW693828 NF069E04ST1F1034 Developing stem Medicago truncatula cDNA clone
NF069E04ST 5', mRNA sequence
Length = 604
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 338 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 397
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 398 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 453
>gb|BG450081.1|BG450081 NF011E06DT1F1051 Drought Medicago truncatula cDNA clone NF011E06DT
5', mRNA sequence
Length = 621
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 336 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 395
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 396 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 451
>gb|BI308280.1|BI308280 EST529690 GPOD Medicago truncatula cDNA clone pGPOD-2L19 5' end,
mRNA sequence
Length = 808
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 338 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 397
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 398 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 453
Score = 40.1 bits (20), Expect = 0.24
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 439 ggtgttggggtctataatcctggctactggggcatgaacattga 482
|||||||| || ||||| ||||| | |||||||||||| |||||
Sbjct: 575 ggtgttggcgtttataaccctggtttctggggcatgaatattga 618
>gb|BQ148260.1|BQ148260 NF065D12FL1F1102 Developing flower Medicago truncatula cDNA clone
NF065D12FL 5', mRNA sequence
Length = 664
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 317 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 376
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 377 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 432
Score = 40.1 bits (20), Expect = 0.24
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 439 ggtgttggggtctataatcctggctactggggcatgaacattga 482
|||||||| || ||||| ||||| | |||||||||||| |||||
Sbjct: 554 ggtgttggcgtttataaccctggtttctggggcatgaatattga 597
>gb|AJ498016.1|AJ498016 AJ498016 MTPOSE Medicago truncatula cDNA clone mt--acc955200a10,
mRNA sequence
Length = 565
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 190 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 249
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 250 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 305
>gb|CB891685.1|CB891685 EST648654 KV3 Medicago truncatula cDNA clone KV3-51D17, mRNA
sequence
Length = 469
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Minus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 435 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 376
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 375 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 320
Score = 40.1 bits (20), Expect = 0.24
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 439 ggtgttggggtctataatcctggctactggggcatgaacattga 482
|||||||| || ||||| ||||| | |||||||||||| |||||
Sbjct: 198 ggtgttggcgtttataaccctggtttctggggcatgaatattga 155
>gb|CF068981.1|CF068981 EST669702 MTUS Medicago truncatula cDNA clone MTUS-14H2, mRNA
sequence
Length = 530
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 280 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 339
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 340 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 395
>gb|CX523840.1|CX523840 s13dNF05F06AT059_440078 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 547
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 369 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 428
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 429 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 484
>gb|CX535243.1|CX535243 s13dNF37C05MJ038_388663 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 437
Score = 111 bits (56), Expect = 8e-023
Identities = 101/116 (87%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 183 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 242
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 243 gtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 298
>gb|AW689696.1|AW689696 NF023D01ST1F1000 Developing stem Medicago truncatula cDNA clone
NF023D01ST 5', mRNA sequence
Length = 634
Score = 105 bits (53), Expect = 5e-021
Identities = 100/116 (86%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 316 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 375
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
|| ||||||| ||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 376 gtgagcaacanaggatttgaagctggaggccctaacattccgtcgaatattgatcc 431
>gb|BF647863.1|BF647863 NF038B02EC1F1016 Elicited cell culture Medicago truncatula cDNA
clone NF038B02EC 5', mRNA sequence
Length = 614
Score = 105 bits (53), Expect = 5e-021
Identities = 102/117 (87%), Gaps = 1/117 (0%)
Strand = Plus / Plus
Query: 190 tttggcatctttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagctt 249
||||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 342 tttggaatattttttgaggagatcaatcatgctggagctgggggattgtgggctgagctt 401
Query: 250 gtaagcaacagaggatttgaggctggtgggcctaataca-ccttcgaatattgatcc 305
|| ||||||||||||||||| ||||| || ||||| | | || ||||||||||||||
Sbjct: 402 gtgagcaacagaggatttgaagctggaggccctaacatanccgtcgaatattgatcc 458
>gb|AC141107.5| Medicago truncatula clone mth2-34a12, complete sequence
Length = 142659
Score = 75.8 bits (38), Expect = 4e-012
Identities = 53/58 (91%)
Strand = Plus / Plus
Query: 206 aggagatcaaccatgctggagctggtgggttgtgggcagagcttgtaagcaacagagg 263
|||||||||| |||||||||||||| || |||||||| |||||||| |||||||||||
Sbjct: 54739 aggagatcaatcatgctggagctgggggattgtgggctgagcttgtgagcaacagagg 54796
Score = 52.0 bits (26), Expect = 6e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 206 aggagatcaaccatgctggagctggtgggttgtgggcagagcttgtaagcaacagagg 263
|||||||||| ||||||||||||||||| || ||| | || ||||| | |||||||||
Sbjct: 72108 aggagatcaatcatgctggagctggtggattatggtctgaacttgtgaacaacagagg 72165
Score = 42.1 bits (21), Expect = 0.060
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 206 aggagatcaaccatgctggagctgg 230
|||||||||||||||||||| ||||
Sbjct: 88684 aggagatcaaccatgctggatctgg 88708
>gb|BI270386.1|BI270386 NF010G07FL1F1056 Developing flower Medicago truncatula cDNA clone
NF010G07FL 5', mRNA sequence
Length = 259
Score = 61.9 bits (31), Expect = 6e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 205 gaggagatcaaccatgctggagctggtgggttgtgggcagagcttgt 251
||||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 213 gaggagatcaatcatgctggagctgggggattgtgggctgagcttgt 259
>gb|CX535093.1|CX535093 s13dNF36H09MJ080_388365 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 505
Score = 60.0 bits (30), Expect = 3e-007
Identities = 54/62 (87%)
Strand = Plus / Plus
Query: 244 gagcttgtaagcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgat 303
|||||||| ||||||||||||||||| ||||| || ||||| | || ||||||||||||
Sbjct: 12 gagcttgtgagcaacagaggatttgaagctggaggccctaacattccgtcgaatattgat 71
Query: 304 cc 305
||
Sbjct: 72 cc 73
Score = 40.1 bits (20), Expect = 0.24
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 439 ggtgttggggtctataatcctggctactggggcatgaacattga 482
|||||||| || ||||| ||||| | |||||||||||| |||||
Sbjct: 195 ggtgttggcgtttataaccctggtttctggggcatgaatattga 238
>gb|CX542040.1|CX542040 s13dNF89D01GS014_467388 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 522
Score = 50.1 bits (25), Expect = 2e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 253 agcaacagaggatttgaggctggtgggcctaatacaccttcgaatattgatcc 305
||||||||||||||||| ||||| || ||||| | || ||||||||||||||
Sbjct: 5 agcaacagaggatttgaagctggaggccctaacattccgtcgaatattgatcc 57
Score = 40.1 bits (20), Expect = 0.24
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 439 ggtgttggggtctataatcctggctactggggcatgaacattga 482
|||||||| || ||||| ||||| | |||||||||||| |||||
Sbjct: 179 ggtgttggcgtttataaccctggtttctggggcatgaatattga 222
>gb|AW685281.1|AW685281 NF027B07NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF027B07NR 5', mRNA sequence
Length = 651
Score = 44.1 bits (22), Expect = 0.015
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 205 gaggagatcaaccatgctggagctgg 230
||||||||||||||||||||| ||||
Sbjct: 185 gaggagatcaaccatgctggatctgg 210
>gb|AC161401.2| Medicago truncatula chromosome 7 clone mte1-59b16, *** SEQUENCING IN
PROGRESS ***, 2 ordered pieces
Length = 95675
Score = 42.1 bits (21), Expect = 0.060
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 199 tttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagcttgt 251
|||||| |||| || || ||||| |||||||| || ||||||||||| |||||
Sbjct: 40436 tttttccaggaaattaatcatgcaggagctgggggattgtgggcagaacttgt 40488
Score = 42.1 bits (21), Expect = 0.060
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 199 tttttcgaggagatcaaccatgctggagctggtgggttgtgggcagagcttgt 251
|||||| |||| || || ||||| |||||||| || ||||||||||| |||||
Sbjct: 4537 tttttccaggaaattaatcatgcaggagctgggggattgtgggcagaacttgt 4589
>gb|CB892038.1|CB892038 EST649007 KV3 Medicago truncatula cDNA clone KV3-53A7, mRNA
sequence
Length = 569
Score = 40.1 bits (20), Expect = 0.24
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 439 ggtgttggggtctataatcctggctactggggcatgaacattga 482
|||||||| || ||||| ||||| | |||||||||||| |||||
Sbjct: 166 ggtgttggcgtttataaccctggtttctggggcatgaatattga 209
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 139,358
Number of Sequences: 392609
Number of extensions: 139358
Number of successful extensions: 9657
Number of sequences better than 0.5: 20
Number of HSP's better than 0.5 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9605
Number of HSP's gapped (non-prelim): 51
length of query: 677
length of database: 441,732,993
effective HSP length: 19
effective length of query: 658
effective length of database: 434,273,422
effective search space: 285751911676
effective search space used: 285751911676
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)