BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBTB.006E19F020311.3.1
         (789 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC146548.9|  Medicago truncatula clone mth2-2p3, complete...    42   0.070
gb|AC171394.2|  Medicago truncatula clone mth2-38p7, WORKING...    42   0.070
gb|AC146329.18|  Medicago truncatula clone mth2-5i21, comple...    42   0.070
gb|AC134967.20|  Medicago truncatula clone mth2-26b8, comple...    40   0.28 
gb|AC169788.4|  Medicago truncatula clone mth2-28c18, comple...    40   0.28 
>gb|AC146548.9| Medicago truncatula clone mth2-2p3, complete sequence
          Length = 129327

 Score = 42.1 bits (21), Expect = 0.070
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 494    ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
              ||||| ||||||||||| || ||  |||| || |||||||||||||| |||||
Sbjct: 118427 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 118375

 Score = 42.1 bits (21), Expect = 0.070
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 494    ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
              ||||| ||||||||||| || ||  |||| || |||||||||||||| |||||
Sbjct: 100637 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 100585
>gb|AC171394.2| Medicago truncatula clone mth2-38p7, WORKING DRAFT SEQUENCE, 2
            unordered pieces
          Length = 91342

 Score = 42.1 bits (21), Expect = 0.070
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 494  ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
            ||||| ||||||||||| || ||  |||| || |||||||||||||| |||||
Sbjct: 4301 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 4249
>gb|AC146329.18| Medicago truncatula clone mth2-5i21, complete sequence
          Length = 129327

 Score = 42.1 bits (21), Expect = 0.070
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 494    ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
              ||||| ||||||||||| || ||  |||| || |||||||||||||| |||||
Sbjct: 118427 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 118375

 Score = 42.1 bits (21), Expect = 0.070
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 494    ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
              ||||| ||||||||||| || ||  |||| || |||||||||||||| |||||
Sbjct: 100637 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 100585
>gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete sequence
          Length = 133030

 Score = 40.1 bits (20), Expect = 0.28
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   attatcaaccatgaattttt 147
             ||||||||||||||||||||
Sbjct: 44275 attatcaaccatgaattttt 44256
>gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete sequence
          Length = 122876

 Score = 40.1 bits (20), Expect = 0.28
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 128   attatcaaccatgaattttt 147
             ||||||||||||||||||||
Sbjct: 77429 attatcaaccatgaattttt 77448
  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 278,808
Number of Sequences: 392609
Number of extensions: 278808
Number of successful extensions: 20575
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20526
Number of HSP's gapped (non-prelim): 49
length of query: 789
length of database: 441,732,993
effective HSP length: 20
effective length of query: 769
effective length of database: 433,880,813
effective search space: 333654345197
effective search space used: 333654345197
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)