BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBL17f07.xg.2.1
         (657 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG935467.1|CG935467  MBEFC81TR mth2 Medicago truncatula g...    40   0.23 
gb|AC148397.13|  Medicago truncatula clone mth2-22h4, comple...    40   0.23 
gb|AC150978.15|  Medicago truncatula clone mth2-66m17, compl...    40   0.23 

>gb|CG935467.1|CG935467 MBEFC81TR mth2 Medicago truncatula genomic clone 42N17, DNA
           sequence
          Length = 492

 Score = 40.1 bits (20), Expect = 0.23
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 tcgctgctgctgctgctgaa 317
           ||||||||||||||||||||
Sbjct: 416 tcgctgctgctgctgctgaa 397



>gb|AC148397.13| Medicago truncatula clone mth2-22h4, complete sequence
          Length = 131213

 Score = 40.1 bits (20), Expect = 0.23
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  tcgctgctgctgctgctgaa 317
            ||||||||||||||||||||
Sbjct: 7575 tcgctgctgctgctgctgaa 7556



>gb|AC150978.15| Medicago truncatula clone mth2-66m17, complete sequence
          Length = 125121

 Score = 40.1 bits (20), Expect = 0.23
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 298    tcgctgctgctgctgctgaa 317
              ||||||||||||||||||||
Sbjct: 108640 tcgctgctgctgctgctgaa 108621



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 91,175
Number of Sequences: 392609
Number of extensions: 91175
Number of successful extensions: 8885
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8873
Number of HSP's gapped (non-prelim): 6
length of query: 657
length of database: 441,732,993
effective HSP length: 19
effective length of query: 638
effective length of database: 434,273,422
effective search space: 277066443236
effective search space used: 277066443236
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)