BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBH4g04.xg.3.1
(1549 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI974677.1|AI974677 T113132e KV2 Medicago truncatula cDN... 42 0.14
gb|AW574034.1|AW574034 EST316625 GVN Medicago truncatula cD... 42 0.14
gb|AW684358.1|AW684358 NF016A07NR1F1000 Nodulated root Medi... 42 0.14
gb|AW684711.1|AW684711 NF020A06NR1F1000 Nodulated root Medi... 42 0.14
gb|AW685380.1|AW685380 NF028B05NR1F1000 Nodulated root Medi... 42 0.14
gb|AW127138.2|AW127138 M110072e GVN Medicago truncatula cDN... 42 0.14
gb|AW208125.2|AW208125 M110758e GVSN Medicago truncatula cD... 42 0.14
gb|AW980483.1|AW980483 EST391636 GVN Medicago truncatula cD... 42 0.14
gb|AW980852.1|AW980852 EST392005 GVN Medicago truncatula cD... 42 0.14
gb|AW981070.1|AW981070 EST392223 GVN Medicago truncatula cD... 42 0.14
gb|BE124357.1|BE124357 EST393392 GVN Medicago truncatula cD... 42 0.14
gb|BE124456.1|BE124456 EST393491 GVN Medicago truncatula cD... 42 0.14
gb|BE124535.1|BE124535 EST393570 GVN Medicago truncatula cD... 42 0.14
gb|BE124775.1|BE124775 EST393810 GVN Medicago truncatula cD... 42 0.14
gb|BE202643.1|BE202643 EST402665 KV1 Medicago truncatula cD... 42 0.14
gb|AL367124.1|AL367124 MtBA12D05R1 MtBA Medicago truncatula... 42 0.14
gb|AL367876.1|AL367876 MtBA19H01F1 MtBA Medicago truncatula... 42 0.14
gb|AL368943.1|AL368943 MtBA27H03F1 MtBA Medicago truncatula... 42 0.14
gb|AL369973.1|AL369973 MtBA34F06F1 MtBA Medicago truncatula... 42 0.14
gb|AL370217.1|AL370217 MtBA36D09F1 MtBA Medicago truncatula... 42 0.14
gb|AL370747.1|AL370747 MtBA39F12F1 MtBA Medicago truncatula... 42 0.14
gb|AL372687.1|AL372687 MtBA52G07R1 MtBA Medicago truncatula... 42 0.14
gb|BE997759.1|BE997759 EST429482 GVSN Medicago truncatula c... 42 0.14
gb|BE997771.1|BE997771 EST429494 GVSN Medicago truncatula c... 42 0.14
gb|BE997801.1|BE997801 EST429524 GVSN Medicago truncatula c... 42 0.14
gb|BE997947.1|BE997947 EST429670 GVSN Medicago truncatula c... 42 0.14
gb|BE998295.1|BE998295 EST430018 GVSN Medicago truncatula c... 42 0.14
gb|BF644594.1|BF644594 NF017C06EC1F1049 Elicited cell cultu... 42 0.14
gb|BF645155.1|BF645155 NF030C10EC1F1081 Elicited cell cultu... 42 0.14
gb|BF648014.1|BF648014 NF025C06EC1F1049 Elicited cell cultu... 42 0.14
gb|AW691186.2|AW691186 NF042A09ST1F1000 Developing stem Med... 42 0.14
gb|BG452890.1|BG452890 NF086E07LF1F1052 Developing leaf Med... 42 0.14
gb|BG580079.1|BG580079 EST481801 GVN Medicago truncatula cD... 42 0.14
gb|BG581453.1|BG581453 EST483187 GVN Medicago truncatula cD... 42 0.14
gb|BG581528.1|BG581528 EST483262 GVN Medicago truncatula cD... 42 0.14
gb|BG583253.1|BG583253 EST485003 GVN Medicago truncatula cD... 42 0.14
gb|BG583415.1|BG583415 EST485167 GVN Medicago truncatula cD... 42 0.14
gb|BG583887.1|BG583887 EST485646 GVN Medicago truncatula cD... 42 0.14
gb|BG644816.1|BG644816 EST506435 KV3 Medicago truncatula cD... 42 0.14
gb|BG644900.1|BG644900 EST506519 KV3 Medicago truncatula cD... 42 0.14
gb|BG645928.1|BG645928 EST507547 KV3 Medicago truncatula cD... 42 0.14
gb|BG646354.1|BG646354 EST507973 HOGA Medicago truncatula c... 42 0.14
gb|BG648632.1|BG648632 EST510251 HOGA Medicago truncatula c... 42 0.14
gb|BI270730.1|BI270730 NF054C07FL1F1054 Developing flower M... 42 0.14
gb|BQ141365.1|BQ141365 NF018G05PH1F1040 Phoma-infected Medi... 42 0.14
gb|CX530461.1|CX530461 s13dNF41D05MJ043_246953 Methyl Jasmo... 42 0.14
gb|CX530941.1|CX530941 s13dNF35E04MJ024_248023 Methyl Jasmo... 42 0.14
gb|CX535460.1|CX535460 s13dNF86F04MJ043_389089 Methyl Jasmo... 42 0.14
>gb|AI974677.1|AI974677 T113132e KV2 Medicago truncatula cDNA clone pKV2-1F20, mRNA
sequence
Length = 269
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 24 ttcggtgagatgctgatcgactttgtccc 52
>gb|AW574034.1|AW574034 EST316625 GVN Medicago truncatula cDNA clone pGVN-50L16, mRNA
sequence
Length = 737
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|AW684358.1|AW684358 NF016A07NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF016A07NR 5', mRNA sequence
Length = 484
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 93 ttcggtgagatgctgatcgactttgtccc 121
>gb|AW684711.1|AW684711 NF020A06NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF020A06NR 5', mRNA sequence
Length = 501
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 102 ttcggtgagatgctgatcgactttgtccc 130
>gb|AW685380.1|AW685380 NF028B05NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF028B05NR 5', mRNA sequence
Length = 448
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 108 ttcggtgagatgctgatcgactttgtccc 136
>gb|AW127138.2|AW127138 M110072e GVN Medicago truncatula cDNA clone N119, mRNA sequence
Length = 404
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 110 ttcggtgagatgctgatcgactttgtccc 138
>gb|AW208125.2|AW208125 M110758e GVSN Medicago truncatula cDNA clone SN23, mRNA sequence
Length = 320
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 120 ttcggtgagatgctgatcgactttgtccc 148
>gb|AW980483.1|AW980483 EST391636 GVN Medicago truncatula cDNA clone pGVN-30P12, mRNA
sequence
Length = 654
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 35 ttcggtgagatgctgatcgactttgtccc 63
>gb|AW980852.1|AW980852 EST392005 GVN Medicago truncatula cDNA clone pGVN-58N2, mRNA
sequence
Length = 608
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 25 ttcggtgagatgctgatcgactttgtccc 53
>gb|AW981070.1|AW981070 EST392223 GVN Medicago truncatula cDNA clone pGVN-60D18, mRNA
sequence
Length = 619
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BE124357.1|BE124357 EST393392 GVN Medicago truncatula cDNA clone pGVN-58E21, mRNA
sequence
Length = 619
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BE124456.1|BE124456 EST393491 GVN Medicago truncatula cDNA clone pGVN-59N23, mRNA
sequence
Length = 503
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggggagatgctgatcgactttgtccc 106
>gb|BE124535.1|BE124535 EST393570 GVN Medicago truncatula cDNA clone pGVN-59N24, mRNA
sequence
Length = 516
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BE124775.1|BE124775 EST393810 GVN Medicago truncatula cDNA clone pGVN-67J19, mRNA
sequence
Length = 552
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BE202643.1|BE202643 EST402665 KV1 Medicago truncatula cDNA clone pKV1-2K24, mRNA
sequence
Length = 559
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|AL367124.1|AL367124 MtBA12D05R1 MtBA Medicago truncatula cDNA clone MtBA12D05 T7, mRNA
sequence
Length = 295
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 196 ttcggtgagatgctgatcgactttgtccc 168
>gb|AL367876.1|AL367876 MtBA19H01F1 MtBA Medicago truncatula cDNA clone MtBA19H01 T3, mRNA
sequence
Length = 294
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 102 ttcggtgagatgctgatcgactttgtccc 130
>gb|AL368943.1|AL368943 MtBA27H03F1 MtBA Medicago truncatula cDNA clone MtBA27H03 T3, mRNA
sequence
Length = 443
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 99 ttcggtgagatgctgatcgactttgtccc 127
>gb|AL369973.1|AL369973 MtBA34F06F1 MtBA Medicago truncatula cDNA clone MtBA34F06 T3, mRNA
sequence
Length = 460
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 95 ttcggtgagatgctgatcgactttgtccc 123
>gb|AL370217.1|AL370217 MtBA36D09F1 MtBA Medicago truncatula cDNA clone MtBA36D09 T3, mRNA
sequence
Length = 430
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 100 ttcggtgagatgctgatcgactttgtccc 128
>gb|AL370747.1|AL370747 MtBA39F12F1 MtBA Medicago truncatula cDNA clone MtBA39F12 T3, mRNA
sequence
Length = 402
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 95 ttcggtgagatgctgatcgactttgtccc 123
>gb|AL372687.1|AL372687 MtBA52G07R1 MtBA Medicago truncatula cDNA clone MtBA52G07 T7, mRNA
sequence
Length = 441
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 344 ttcggtgagatgctgatcgactttgtccc 316
>gb|BE997759.1|BE997759 EST429482 GVSN Medicago truncatula cDNA clone pGVSN-4G21, mRNA
sequence
Length = 614
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BE997771.1|BE997771 EST429494 GVSN Medicago truncatula cDNA clone pGVSN-4K9, mRNA
sequence
Length = 583
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 69 ttcggtgagatgctgatcgactttgtccc 97
>gb|BE997801.1|BE997801 EST429524 GVSN Medicago truncatula cDNA clone pGVSN-8A5, mRNA
sequence
Length = 279
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 73 ttcggagagatgctgatcgactttgtccc 101
>gb|BE997947.1|BE997947 EST429670 GVSN Medicago truncatula cDNA clone pGVSN-8O8, mRNA
sequence
Length = 554
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BE998295.1|BE998295 EST430018 GVSN Medicago truncatula cDNA clone pGVSN-9B5, mRNA
sequence
Length = 582
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 63 ttcggtgagatgctgatcgactttgtccc 91
>gb|BF644594.1|BF644594 NF017C06EC1F1049 Elicited cell culture Medicago truncatula cDNA
clone NF017C06EC 5', mRNA sequence
Length = 672
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 95 ttcggtgagatgctgatcgactttgtccc 123
>gb|BF645155.1|BF645155 NF030C10EC1F1081 Elicited cell culture Medicago truncatula cDNA
clone NF030C10EC 5', mRNA sequence
Length = 430
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 95 ttcggtgagatgctgatcgactttgtccc 123
>gb|BF648014.1|BF648014 NF025C06EC1F1049 Elicited cell culture Medicago truncatula cDNA
clone NF025C06EC 5', mRNA sequence
Length = 649
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 101 ttcggtgagatgctgatcgactttgtccc 129
>gb|AW691186.2|AW691186 NF042A09ST1F1000 Developing stem Medicago truncatula cDNA clone
NF042A09ST 5', mRNA sequence
Length = 422
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 94 ttcggtgagatgctgatcgactttgtccc 122
>gb|BG452890.1|BG452890 NF086E07LF1F1052 Developing leaf Medicago truncatula cDNA clone
NF086E07LF 5', mRNA sequence
Length = 660
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 95 ttcggtgagatgctgatcgactttgtccc 123
>gb|BG580079.1|BG580079 EST481801 GVN Medicago truncatula cDNA clone pGVN-36N19 5' end,
mRNA sequence
Length = 452
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 77 ttcggtgagatgctgatcgactttgtccc 105
>gb|BG581453.1|BG581453 EST483187 GVN Medicago truncatula cDNA clone pGVN-64L12 5' end,
mRNA sequence
Length = 806
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BG581528.1|BG581528 EST483262 GVN Medicago truncatula cDNA clone pGVN-65I19 5' end,
mRNA sequence
Length = 724
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BG583253.1|BG583253 EST485003 GVN Medicago truncatula cDNA clone pGVN-72K3 5' end, mRNA
sequence
Length = 736
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 7 ttcggtgagatgctgatcgactttgtccc 35
>gb|BG583415.1|BG583415 EST485167 GVN Medicago truncatula cDNA clone pGVN-73M23 5' end,
mRNA sequence
Length = 777
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BG583887.1|BG583887 EST485646 GVN Medicago truncatula cDNA clone pGVN-74H14 5' end,
mRNA sequence
Length = 743
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BG644816.1|BG644816 EST506435 KV3 Medicago truncatula cDNA clone pKV3-38M12 5' end,
mRNA sequence
Length = 764
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 77 ttcggtgagatgctgatcgactttgtccc 105
>gb|BG644900.1|BG644900 EST506519 KV3 Medicago truncatula cDNA clone pKV3-38N5 5' end, mRNA
sequence
Length = 707
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|BG645928.1|BG645928 EST507547 KV3 Medicago truncatula cDNA clone pKV3-48A9 5' end, mRNA
sequence
Length = 764
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 77 ttcggtgagatgctgatcgactttgtccc 105
>gb|BG646354.1|BG646354 EST507973 HOGA Medicago truncatula cDNA clone pHOGA-7G10 5' end,
mRNA sequence
Length = 631
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 79 ttcggtgagatgctgatcgactttgtccc 107
>gb|BG648632.1|BG648632 EST510251 HOGA Medicago truncatula cDNA clone pHOGA-23G20 5' end,
mRNA sequence
Length = 718
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 75 ttcggtgagatgctgatcgactttgtccc 103
>gb|BI270730.1|BI270730 NF054C07FL1F1054 Developing flower Medicago truncatula cDNA clone
NF054C07FL 5', mRNA sequence
Length = 658
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 96 ttcggtgagatgctgatcgactttgtccc 124
>gb|BQ141365.1|BQ141365 NF018G05PH1F1040 Phoma-infected Medicago truncatula cDNA clone
NF018G05PH 5', mRNA sequence
Length = 424
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 104 ttcggtgagatgctgatcgactttgtccc 132
>gb|CX530461.1|CX530461 s13dNF41D05MJ043_246953 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 498
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 109 ttcggtgagatgctgatcgactttgtccc 137
>gb|CX530941.1|CX530941 s13dNF35E04MJ024_248023 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 463
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
>gb|CX535460.1|CX535460 s13dNF86F04MJ043_389089 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 522
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 173 ttcggcgagatgctgatcgacttcgtccc 201
||||| ||||||||||||||||| |||||
Sbjct: 78 ttcggtgagatgctgatcgactttgtccc 106
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 158,831
Number of Sequences: 392609
Number of extensions: 158831
Number of successful extensions: 11359
Number of sequences better than 0.5: 48
Number of HSP's better than 0.5 without gapping: 48
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11264
Number of HSP's gapped (non-prelim): 95
length of query: 1549
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1529
effective length of database: 433,880,813
effective search space: 663403763077
effective search space used: 663403763077
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)