BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAM14e11.yg.2.1
(197 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ137986.1|BQ137986 NF008A09PH1F1066 Phoma-infected Medi... 58 3e-007
emb|CR503946.1| mth2-181P20FM1 BAC end, cultivar Jemalong A... 44 0.004
emb|CR512935.1| mth4-37D8FM1 BAC end, cultivar Jemalong A17... 38 0.25
gb|AC140720.21| Medicago truncatula clone mth2-17l10, compl... 38 0.25
gb|AC174336.3| Medicago truncatula clone mth2-157o10, WORKI... 38 0.25
>gb|BQ137986.1|BQ137986 NF008A09PH1F1066 Phoma-infected Medicago truncatula cDNA clone
NF008A09PH 5', mRNA sequence
Length = 658
Score = 58.0 bits (29), Expect = 3e-007
Identities = 149/189 (78%)
Strand = Plus / Minus
Query: 5 tccccactgttcatcaatctcctgccttgtgctggtgatgacaagctctgacgcatccag 64
|||||| ||||||||||| || || ||||| || ||||||||||| |||| ||||||||
Sbjct: 650 tccccattgttcatcaatttcttgtcttgtactagtgatgacaagttctgcagcatccag 591
Query: 65 ggccagctcctcaccctcgatacgcctcatgatcttgtatgttgaatcgatctcctcctt 124
|| ||||| || | || || | ||||| ||||| || ||||||| ||| ||||||
Sbjct: 590 ggaaagctcttctgcttctatccttctcattatcttatacgttgaattgatatcctccca 531
Query: 125 ggacatgcgcccttgcttcaggatttgctccagcttgttcctcccaagtgagtgaccagt 184
|| |||||||||||| || | ||| || || ||||| || |||||||| ||||||||
Sbjct: 530 agattggcgcccttgcttaagaagttgttctagtttgtttcttccaagtgaatgaccagt 471
Query: 185 gagcaccat 193
||| |||||
Sbjct: 470 gagaaccat 462
>emb|CR503946.1| mth2-181P20FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 510
Score = 44.1 bits (22), Expect = 0.004
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 5 tccccactgttcatcaatctcctgccttgtgctggtgatgacaagctctg 54
|||||| ||||||||||| || || ||||| || ||||||||||| ||||
Sbjct: 457 tccccattgttcatcaatttcttgtcttgtactagtgatgacaagttctg 506
>emb|CR512935.1| mth4-37D8FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 343
Score = 38.2 bits (19), Expect = 0.25
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 93 atgatcttgtatgttgaat 111
|||||||||||||||||||
Sbjct: 139 atgatcttgtatgttgaat 157
>gb|AC140720.21| Medicago truncatula clone mth2-17l10, complete sequence
Length = 122940
Score = 38.2 bits (19), Expect = 0.25
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 93 atgatcttgtatgttgaat 111
|||||||||||||||||||
Sbjct: 88827 atgatcttgtatgttgaat 88845
>gb|AC174336.3| Medicago truncatula clone mth2-157o10, WORKING DRAFT SEQUENCE
Length = 37185
Score = 38.2 bits (19), Expect = 0.25
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 93 atgatcttgtatgttgaat 111
|||||||||||||||||||
Sbjct: 3072 atgatcttgtatgttgaat 3090
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 33,327
Number of Sequences: 392609
Number of extensions: 33327
Number of successful extensions: 8421
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8411
Number of HSP's gapped (non-prelim): 10
length of query: 197
length of database: 441,732,993
effective HSP length: 18
effective length of query: 179
effective length of database: 434,666,031
effective search space: 77805219549
effective search space used: 77805219549
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)