BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF12e06.yg.2.1
(561 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR342188.1| mte1-74H8FM1 BAC end, cultivar Jemalong A17... 40 0.19
gb|AW256460.1|AW256460 EST304597 KV2 Medicago truncatula cD... 40 0.19
gb|CX526202.1|CX526202 s13dNF29C12AT098_510148 Aphid-Infect... 40 0.19
gb|AC119418.5| Medicago truncatula clone mth1-23l16, comple... 40 0.19
gb|AC146706.8| Medicago truncatula clone mth2-108g5, comple... 40 0.19
gb|AC135317.10| Medicago truncatula clone mth2-10p4, WORKIN... 40 0.19
gb|AC148918.3| Medicago truncatula chromosome 2 BAC clone m... 40 0.19
emb|CR931731.1| Medicago truncatula chromosome 5 clone mth2... 40 0.19
gb|AC158376.1| Medicago truncatula chromosome 2 clone mth2-... 40 0.19
gb|AC126019.16| Medicago truncatula clone mth2-22p22, compl... 40 0.19
gb|AC150889.3| Medicago truncatula chromosome 7 BAC clone m... 40 0.19
gb|AC158498.3| Medicago truncatula chromosome 2 BAC clone m... 40 0.19
gb|AC151674.9| Medicago truncatula clone mth2-28i16, WORKIN... 40 0.19
emb|CT009568.8| M.truncatula DNA sequence from clone MTH2-9... 40 0.19
gb|AC145027.17| Medicago truncatula clone mth2-15e6, comple... 40 0.19
gb|AC122725.28| Medicago truncatula clone mth2-4c11, WORKIN... 40 0.19
gb|AC147537.31| Medicago truncatula clone mth2-133k2, WORKI... 40 0.19
gb|AC166237.5| Medicago truncatula clone mth2-6a22, WORKING... 40 0.19
>emb|CR342188.1| mte1-74H8FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 743
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 587 tgaatgtcattgaattggat 568
>gb|AW256460.1|AW256460 EST304597 KV2 Medicago truncatula cDNA clone KV2-4B4, mRNA sequence
Length = 479
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 64 tagttgttctggatgatgat 83
||||||||||||||||||||
Sbjct: 349 tagttgttctggatgatgat 368
>gb|CX526202.1|CX526202 s13dNF29C12AT098_510148 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 635
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 64 tagttgttctggatgatgat 83
||||||||||||||||||||
Sbjct: 156 tagttgttctggatgatgat 175
>gb|AC119418.5| Medicago truncatula clone mth1-23l16, complete sequence
Length = 112695
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 106821 tgaatgtcattgaattggat 106802
>gb|AC146706.8| Medicago truncatula clone mth2-108g5, complete sequence
Length = 106753
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 22956 tgaatgtcattgaattggat 22975
>gb|AC135317.10| Medicago truncatula clone mth2-10p4, WORKING DRAFT SEQUENCE, 5 ordered
pieces
Length = 164376
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 61637 tgaatgtcattgaattggat 61618
>gb|AC148918.3| Medicago truncatula chromosome 2 BAC clone mth2-44o11, complete
sequence
Length = 126437
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 91676 tgaatgtcattgaattggat 91695
>emb|CR931731.1| Medicago truncatula chromosome 5 clone mth2-83l19, COMPLETE SEQUENCE
Length = 120299
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 34454 tgaatgtcattgaattggat 34435
>gb|AC158376.1| Medicago truncatula chromosome 2 clone mth2-64d17, *** SEQUENCING IN
PROGRESS ***, 8 unordered pieces
Length = 126018
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 89927 tgaatgtcattgaattggat 89946
>gb|AC126019.16| Medicago truncatula clone mth2-22p22, complete sequence
Length = 130044
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 51526 tgaatgtcattgaattggat 51507
>gb|AC150889.3| Medicago truncatula chromosome 7 BAC clone mte1-61j12, complete
sequence
Length = 116517
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 82793 tgaatgtcattgaattggat 82812
>gb|AC158498.3| Medicago truncatula chromosome 2 BAC clone mth2-65n13, complete
sequence
Length = 124573
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 66913 tgaatgtcattgaattggat 66894
>gb|AC151674.9| Medicago truncatula clone mth2-28i16, WORKING DRAFT SEQUENCE
Length = 128180
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 53085 tgaatgtcattgaattggat 53066
>emb|CT009568.8| M.truncatula DNA sequence from clone MTH2-95K22 on chromosome 3,
complete sequence
Length = 121926
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 40487 tgaatgtcattgaattggat 40506
>gb|AC145027.17| Medicago truncatula clone mth2-15e6, complete sequence
Length = 122014
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 57842 tgaatgtcattgaattggat 57823
>gb|AC122725.28| Medicago truncatula clone mth2-4c11, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 136107
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 92092 tgaatgtcattgaattggat 92111
>gb|AC147537.31| Medicago truncatula clone mth2-133k2, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 162090
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 36674 tgaatgtcattgaattggat 36693
>gb|AC166237.5| Medicago truncatula clone mth2-6a22, WORKING DRAFT SEQUENCE, 13 ordered
pieces
Length = 127651
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 241 tgaatgtcattgaattggat 260
||||||||||||||||||||
Sbjct: 21487 tgaatgtcattgaattggat 21506
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 128,983
Number of Sequences: 392609
Number of extensions: 128983
Number of successful extensions: 9906
Number of sequences better than 0.5: 18
Number of HSP's better than 0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9865
Number of HSP's gapped (non-prelim): 41
length of query: 561
length of database: 441,732,993
effective HSP length: 19
effective length of query: 542
effective length of database: 434,273,422
effective search space: 235376194724
effective search space used: 235376194724
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)