BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAD12g05.sg.3.2
(900 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CG966174.1|CG966174 MBEEA23TFC mth2 Medicago truncatula ... 42 0.080
gb|AC139343.22| Medicago truncatula clone mth2-32l12, WORKI... 42 0.080
gb|AC149474.15| Medicago truncatula clone mth2-122l24, comp... 42 0.080
gb|AC160242.7| Medicago truncatula clone mth2-65g16, WORKIN... 42 0.080
gb|AC149080.12| Medicago truncatula clone mth2-75j5, comple... 42 0.080
gb|AC158119.5| Medicago truncatula clone mth2-89i19, WORKIN... 42 0.080
emb|CR336498.1| mte1-67H9RM1 BAC end, cultivar Jemalong A17... 40 0.32
>gb|CG966174.1|CG966174 MBEEA23TFC mth2 Medicago truncatula genomic clone 36C21, DNA
sequence
Length = 776
Score = 42.1 bits (21), Expect = 0.080
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 793 attttgatggcttaaattctt 813
|||||||||||||||||||||
Sbjct: 332 attttgatggcttaaattctt 312
>gb|AC139343.22| Medicago truncatula clone mth2-32l12, WORKING DRAFT SEQUENCE, 5 ordered
pieces
Length = 102342
Score = 42.1 bits (21), Expect = 0.080
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 4 ttgtcgctgctgccctggttg 24
|||||||||||||||||||||
Sbjct: 90814 ttgtcgctgctgccctggttg 90834
>gb|AC149474.15| Medicago truncatula clone mth2-122l24, complete sequence
Length = 129008
Score = 42.1 bits (21), Expect = 0.080
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 793 attttgatggcttaaattctt 813
|||||||||||||||||||||
Sbjct: 6949 attttgatggcttaaattctt 6929
>gb|AC160242.7| Medicago truncatula clone mth2-65g16, WORKING DRAFT SEQUENCE, 23
unordered pieces
Length = 155209
Score = 42.1 bits (21), Expect = 0.080
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 4 ttgtcgctgctgccctggttg 24
|||||||||||||||||||||
Sbjct: 143434 ttgtcgctgctgccctggttg 143454
>gb|AC149080.12| Medicago truncatula clone mth2-75j5, complete sequence
Length = 96907
Score = 42.1 bits (21), Expect = 0.080
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 793 attttgatggcttaaattctt 813
|||||||||||||||||||||
Sbjct: 64092 attttgatggcttaaattctt 64112
>gb|AC158119.5| Medicago truncatula clone mth2-89i19, WORKING DRAFT SEQUENCE, 27
unordered pieces
Length = 81260
Score = 42.1 bits (21), Expect = 0.080
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 4 ttgtcgctgctgccctggttg 24
|||||||||||||||||||||
Sbjct: 52000 ttgtcgctgctgccctggttg 51980
>emb|CR336498.1| mte1-67H9RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 667
Score = 40.1 bits (20), Expect = 0.32
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 844 tactctttgctcaaacaaat 863
||||||||||||||||||||
Sbjct: 610 tactctttgctcaaacaaat 629
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 172,743
Number of Sequences: 392609
Number of extensions: 172743
Number of successful extensions: 11254
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11231
Number of HSP's gapped (non-prelim): 23
length of query: 900
length of database: 441,732,993
effective HSP length: 20
effective length of query: 880
effective length of database: 433,880,813
effective search space: 381815115440
effective search space used: 381815115440
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)