BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= AF332176.2.1
         (912 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC144645.17|  Medicago truncatula clone mth2-11e15, compl...    40   0.32 
gb|AC166707.9|  Medicago truncatula strain cultivar Jemalong...    40   0.32 

>gb|AC144645.17| Medicago truncatula clone mth2-11e15, complete sequence
          Length = 124394

 Score = 40.1 bits (20), Expect = 0.32
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 822   acctagctagctagctagct 841
             ||||||||||||||||||||
Sbjct: 28042 acctagctagctagctagct 28061



>gb|AC166707.9| Medicago truncatula strain cultivar Jemalong A17 clone mte1-13o17,
             WORKING DRAFT SEQUENCE
          Length = 123664

 Score = 40.1 bits (20), Expect = 0.32
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 824   ctagctagctagctagctgc 843
             ||||||||||||||||||||
Sbjct: 40288 ctagctagctagctagctgc 40307



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 121,256
Number of Sequences: 392609
Number of extensions: 121256
Number of successful extensions: 10566
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10550
Number of HSP's gapped (non-prelim): 12
length of query: 912
length of database: 441,732,993
effective HSP length: 20
effective length of query: 892
effective length of database: 433,880,813
effective search space: 387021685196
effective search space used: 387021685196
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)