BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 5532690.2.1
         (863 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AL376010.1|AL376010  MtBB20F06F1 MtBB Medicago truncatula...    44   0.019
gb|CG975125.1|CG975125  MBEJW32TR mth2 Medicago truncatula g...    40   0.30 
gb|AC152921.8|  Medicago truncatula clone mth2-102h2, comple...    40   0.30 

>gb|AL376010.1|AL376010 MtBB20F06F1 MtBB Medicago truncatula cDNA clone MtBB20F06 T3, mRNA
           sequence
          Length = 491

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 655 taaaatcgatatgttctcccagggtagcctcgtgaaggatcagctctcatgttcatat 712
           |||||||  |||||||| ||||||||||||   | ||||||||  |||||||||||||
Sbjct: 377 taaaatctgtatgttctaccagggtagcctgtagcaggatcaggcctcatgttcatat 320



>gb|CG975125.1|CG975125 MBEJW32TR mth2 Medicago truncatula genomic clone 71F15, DNA
           sequence
          Length = 939

 Score = 40.1 bits (20), Expect = 0.30
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 653 tgtaaaatcgatatgttctcccagggta 680
           ||||||| ||||| ||||||||||||||
Sbjct: 162 tgtaaaaacgataggttctcccagggta 189



>gb|AC152921.8| Medicago truncatula clone mth2-102h2, complete sequence
          Length = 110614

 Score = 40.1 bits (20), Expect = 0.30
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 653   tgtaaaatcgatatgttctcccagggta 680
             ||||||| ||||| ||||||||||||||
Sbjct: 48743 tgtaaaaacgataggttctcccagggta 48770



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 188,219
Number of Sequences: 392609
Number of extensions: 188219
Number of successful extensions: 11423
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11416
Number of HSP's gapped (non-prelim): 7
length of query: 863
length of database: 441,732,993
effective HSP length: 20
effective length of query: 843
effective length of database: 433,880,813
effective search space: 365761525359
effective search space used: 365761525359
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)