BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 4790360.2.1
(667 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ148856.1|BQ148856 NF083B11FL1F1092 Developing flower M... 82 7e-014
gb|AJ499253.1|AJ499253 AJ499253 MTGIM Medicago truncatula c... 82 7e-014
gb|CA920629.1|CA920629 EST638347 MTUS Medicago truncatula c... 76 4e-012
gb|AC144726.6| Medicago truncatula clone mth2-7k13, complet... 40 0.23
gb|AC150505.12| Medicago truncatula clone mth2-99l2, comple... 40 0.23
gb|AC150842.13| Medicago truncatula clone mth2-66f12, WORKI... 40 0.23
>gb|BQ148856.1|BQ148856 NF083B11FL1F1092 Developing flower Medicago truncatula cDNA clone
NF083B11FL 5', mRNA sequence
Length = 669
Score = 81.8 bits (41), Expect = 7e-014
Identities = 68/77 (88%)
Strand = Plus / Plus
Query: 110 aacagtttccgtatgttcagcaacgaggacgttacaattggatcgtggatgcttgctatg 169
|||||||| || ||||||||||| ||||| ||||| |||||| | ||||||||||| |||
Sbjct: 536 aacagttttcggatgttcagcaatgaggatgttaccattggagcttggatgcttgcaatg 595
Query: 170 aacgtcaaccatgagaa 186
|| ||||||||||||||
Sbjct: 596 aatgtcaaccatgagaa 612
>gb|AJ499253.1|AJ499253 AJ499253 MTGIM Medicago truncatula cDNA clone mtgmacc120001h06,
mRNA sequence
Length = 473
Score = 81.8 bits (41), Expect = 7e-014
Identities = 68/77 (88%)
Strand = Plus / Minus
Query: 110 aacagtttccgtatgttcagcaacgaggacgttacaattggatcgtggatgcttgctatg 169
|||||||| || ||||||||||| ||||| ||||| |||||| | ||||||||||| |||
Sbjct: 462 aacagttttcggatgttcagcaatgaggatgttaccattggagcttggatgcttgcaatg 403
Query: 170 aacgtcaaccatgagaa 186
|| ||||||||||||||
Sbjct: 402 aatgtcaaccatgagaa 386
>gb|CA920629.1|CA920629 EST638347 MTUS Medicago truncatula cDNA clone MTUS-30E1, mRNA
sequence
Length = 748
Score = 75.8 bits (38), Expect = 4e-012
Identities = 68/78 (87%)
Strand = Plus / Minus
Query: 111 acagtttccgtatgttcagcaacgaggacgttacaattggatcgtggatgcttgctatga 170
|||||||||| ||||||||||| ||||| ||||| |||||| | |||||||| || ||||
Sbjct: 617 acagtttccggatgttcagcaatgaggatgttactattggagcttggatgctcgcaatga 558
Query: 171 acgtcaaccatgagaaca 188
| ||||| ||||||||||
Sbjct: 557 atgtcaaacatgagaaca 540
>gb|AC144726.6| Medicago truncatula clone mth2-7k13, complete sequence
Length = 138586
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1 ccatgagccccaatcctttttact 24
|||||||| |||||||||||||||
Sbjct: 17483 ccatgagcaccaatcctttttact 17460
>gb|AC150505.12| Medicago truncatula clone mth2-99l2, complete sequence
Length = 111277
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1 ccatgagccccaatcctttttact 24
|||||||| |||||||||||||||
Sbjct: 85460 ccatgagcaccaatcctttttact 85437
>gb|AC150842.13| Medicago truncatula clone mth2-66f12, WORKING DRAFT SEQUENCE, 6 unordered
pieces
Length = 248069
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1 ccatgagccccaatcctttttact 24
|||||||| |||||||||||||||
Sbjct: 108622 ccatgagcaccaatcctttttact 108599
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 167,250
Number of Sequences: 392609
Number of extensions: 167250
Number of successful extensions: 11723
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11701
Number of HSP's gapped (non-prelim): 22
length of query: 667
length of database: 441,732,993
effective HSP length: 19
effective length of query: 648
effective length of database: 434,273,422
effective search space: 281409177456
effective search space used: 281409177456
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)