BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3922840.2.1
(683 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ144385.1|BQ144385 NF074D05DT1F1045 Drought Medicago tr... 40 0.24
gb|AC136506.10| Medicago truncatula clone mth2-33c8, comple... 40 0.24
gb|AC174305.4| Medicago truncatula clone mth2-108j24, WORKI... 40 0.24
>gb|BQ144385.1|BQ144385 NF074D05DT1F1045 Drought Medicago truncatula cDNA clone NF074D05DT
5', mRNA sequence
Length = 1329
Score = 40.1 bits (20), Expect = 0.24
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 510 cagcaggacgacgagcgaga 529
||||||||||||||||||||
Sbjct: 870 cagcaggacgacgagcgaga 889
>gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete sequence
Length = 135457
Score = 40.1 bits (20), Expect = 0.24
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 122 tatgttcatttatttattca 141
||||||||||||||||||||
Sbjct: 9961 tatgttcatttatttattca 9942
>gb|AC174305.4| Medicago truncatula clone mth2-108j24, WORKING DRAFT SEQUENCE, 8
unordered pieces
Length = 52707
Score = 40.1 bits (20), Expect = 0.24
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 122 tatgttcatttatttattca 141
||||||||||||||||||||
Sbjct: 29246 tatgttcatttatttattca 29227
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 141,740
Number of Sequences: 392609
Number of extensions: 141740
Number of successful extensions: 11308
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11300
Number of HSP's gapped (non-prelim): 8
length of query: 683
length of database: 441,732,993
effective HSP length: 19
effective length of query: 664
effective length of database: 434,273,422
effective search space: 288357552208
effective search space used: 288357552208
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)