BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3922840.2.1
         (683 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BQ144385.1|BQ144385  NF074D05DT1F1045 Drought Medicago tr...    40   0.24 
gb|AC136506.10|  Medicago truncatula clone mth2-33c8, comple...    40   0.24 
gb|AC174305.4|  Medicago truncatula clone mth2-108j24, WORKI...    40   0.24 

>gb|BQ144385.1|BQ144385 NF074D05DT1F1045 Drought Medicago truncatula cDNA clone NF074D05DT
           5', mRNA sequence
          Length = 1329

 Score = 40.1 bits (20), Expect = 0.24
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 510 cagcaggacgacgagcgaga 529
           ||||||||||||||||||||
Sbjct: 870 cagcaggacgacgagcgaga 889



>gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete sequence
          Length = 135457

 Score = 40.1 bits (20), Expect = 0.24
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 122  tatgttcatttatttattca 141
            ||||||||||||||||||||
Sbjct: 9961 tatgttcatttatttattca 9942



>gb|AC174305.4| Medicago truncatula clone mth2-108j24, WORKING DRAFT SEQUENCE, 8
             unordered pieces
          Length = 52707

 Score = 40.1 bits (20), Expect = 0.24
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 122   tatgttcatttatttattca 141
             ||||||||||||||||||||
Sbjct: 29246 tatgttcatttatttattca 29227



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 141,740
Number of Sequences: 392609
Number of extensions: 141740
Number of successful extensions: 11308
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11300
Number of HSP's gapped (non-prelim): 8
length of query: 683
length of database: 441,732,993
effective HSP length: 19
effective length of query: 664
effective length of database: 434,273,422
effective search space: 288357552208
effective search space used: 288357552208
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)