BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3871923.2.1
(1030 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI309102.1|BI309102 EST530512 GPOD Medicago truncatula c... 62 1e-007
emb|CR293804.1| mte1-1I8FM1 BAC end, cultivar Jemalong A17 ... 40 0.36
gb|BE319201.2|BE319201 NF045A05LF1F1034 Developing leaf Med... 40 0.36
>gb|BI309102.1|BI309102 EST530512 GPOD Medicago truncatula cDNA clone pGPOD-10N9 5' end,
mRNA sequence
Length = 683
Score = 61.9 bits (31), Expect = 1e-007
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 185 ttcatgtccattggaggattcccttcgttcgttgaagaaatgaaggt 231
|||||||| ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 139 ttcatgtcaattggtggattcccttcgtttgttgaagatatgaaggt 185
Score = 58.0 bits (29), Expect = 2e-006
Identities = 83/101 (82%)
Strand = Plus / Plus
Query: 431 agcttgatgatggcgattgccagtgtcattccaaatttcctcatgggtatcatcataggg 490
||||| |||||||| ||||| ||| | |||| || ||||||||||| || ||||| ||
Sbjct: 385 agcttaatgatggcaattgctagtattgttcctaacttcctcatgggcattatcattgga 444
Query: 491 gccgggattcagggaatattcatgctggtctctggctactt 531
|| || ||||| || || |||||| ||||||||||||||||
Sbjct: 445 gcaggaattcaaggtatcttcatgttggtctctggctactt 485
>emb|CR293804.1| mte1-1I8FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 960
Score = 40.1 bits (20), Expect = 0.36
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1001 ctcttggtgttatattgtat 1020
||||||||||||||||||||
Sbjct: 896 ctcttggtgttatattgtat 877
>gb|BE319201.2|BE319201 NF045A05LF1F1034 Developing leaf Medicago truncatula cDNA clone
NF045A05LF 5', mRNA sequence
Length = 658
Score = 40.1 bits (20), Expect = 0.36
Identities = 34/39 (87%)
Strand = Plus / Plus
Query: 13 accaancgctccttcatcaacatgtcgcgggactttggt 51
||||| || |||||||| |||||||| |||||||||||
Sbjct: 437 accaaacgttccttcattaacatgtcaagggactttggt 475
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 181,057
Number of Sequences: 392609
Number of extensions: 181057
Number of successful extensions: 13424
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13420
Number of HSP's gapped (non-prelim): 4
length of query: 1030
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1010
effective length of database: 433,880,813
effective search space: 438219621130
effective search space used: 438219621130
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)