BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3871878.2.1
(950 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA921800.1|CA921800 EST639518 MTUS Medicago truncatula c... 157 2e-036
gb|BF646432.1|BF646432 NF072B12EC1F1096 Elicited cell cultu... 84 2e-014
gb|BE325403.2|BE325403 NF087E12ST1F1087 Developing stem Med... 84 2e-014
gb|BG451915.1|BG451915 NF101F03DT1F1028 Drought Medicago tr... 84 2e-014
gb|BG647622.1|BG647622 EST509241 HOGA Medicago truncatula c... 84 2e-014
gb|AC152937.21| Medicago truncatula clone mth2-96n6, comple... 80 4e-013
gb|BF004708.1|BF004708 EST433206 KV1 Medicago truncatula cD... 74 2e-011
gb|BQ139277.1|BQ139277 NF013E12PH1F1088 Phoma-infected Medi... 72 9e-011
gb|AC147012.23| Medicago truncatula clone mth2-151j16, WORK... 62 9e-008
gb|AC174367.2| Medicago truncatula clone mth2-47m8, WORKING... 62 9e-008
gb|AC181973.1| Medicago truncatula clone mth2-12f6, WORKING... 62 9e-008
gb|AW692995.1|AW692995 NF058A10ST1F1000 Developing stem Med... 44 0.021
gb|BE318343.1|BE318343 NF037A12LF1F1086 Developing leaf Med... 44 0.021
gb|BG449719.1|BG449719 NF007B04IN1F1030 Insect herbivory Me... 44 0.021
gb|BG454948.1|BG454948 NF111A03LF1F1018 Developing leaf Med... 44 0.021
gb|BI309043.1|BI309043 EST530453 GPOD Medicago truncatula c... 44 0.021
gb|CF069593.1|CF069593 EST670314 MTUS Medicago truncatula c... 44 0.021
gb|DW016381.1|DW016381 EST1225342 MTY Medicago truncatula c... 44 0.021
gb|DW016709.1|DW016709 EST1225670 MTY Medicago truncatula c... 44 0.021
gb|BG646200.1|BG646200 EST507819 KV3 Medicago truncatula cD... 42 0.084
gb|AW690944.1|AW690944 NF039A07ST1F1000 Developing stem Med... 40 0.33
gb|BE124847.1|BE124847 EST393882 GVN Medicago truncatula cD... 40 0.33
gb|AL369577.1|AL369577 MtBA32A07F1 MtBA Medicago truncatula... 40 0.33
gb|BF640544.1|BF640544 NF036F12IN1F1102 Insect herbivory Me... 40 0.33
gb|AW692447.2|AW692447 NF051E05ST1F1000 Developing stem Med... 40 0.33
gb|BI308850.1|BI308850 EST530260 GPOD Medicago truncatula c... 40 0.33
gb|AJ499098.1|AJ499098 AJ499098 MTPOSE Medicago truncatula ... 40 0.33
>gb|CA921800.1|CA921800 EST639518 MTUS Medicago truncatula cDNA clone MTUS-44E8, mRNA
sequence
Length = 817
Score = 157 bits (79), Expect = 2e-036
Identities = 226/275 (82%)
Strand = Plus / Minus
Query: 104 cgggcaatacgcacctcaacaccagcaccacgatgatagtccatagttgaagtctcggct 163
||||||||||| | ||||| |||||||| |||||||| ||||||| ||||||||
Sbjct: 768 cgggcaatacgaccttcaacgccagcacctcgatgataatccatagcaagtgtctcggca 709
Query: 164 gttctcttcccctcatcataacagctcctaacaccaataggattaacgtgcccccagtat 223
|||| ||| || ||||||||||| ||||| ||||||| |||||||| | |||||||||
Sbjct: 708 gttcgctttccttcatcataacaactcctctcaccaattggattaacattcccccagtaa 649
Query: 224 gactccttctgtggatgctcaagtggatcaccataaacttcacttgtgctagtcaacaaa 283
| ||| ||||| |||||||| | ||||||||||| || ||||| || ||||| || | |
Sbjct: 648 gtctctttctgaggatgctccaaaggatcaccatatacctcactagtactagttaaaaga 589
Query: 284 aaccttgcaccaactcgctttgccagacccaacatattcaaagttcccatgacatttgtc 343
||||| || |||| || |||||| || ||||||||||| | || ||||| |||||||||
Sbjct: 588 aacctcgccccaattctctttgctagccccaacatattaagtgtacccatcacatttgtc 529
Query: 344 ttgatcgtcttgattgggttatacttgtaatgaac 378
||||| |||||||| ||||||||||| ||||||||
Sbjct: 528 ttgattgtcttgatagggttatacttataatgaac 494
>gb|BF646432.1|BF646432 NF072B12EC1F1096 Elicited cell culture Medicago truncatula cDNA
clone NF072B12EC 5', mRNA sequence
Length = 637
Score = 83.8 bits (42), Expect = 2e-014
Identities = 84/98 (85%)
Strand = Plus / Minus
Query: 173 ccctcatcataacagctcctaacaccaataggattaacgtgcccccagtatgactccttc 232
|||||||| || ||||| | |||||||| |||||||||| |||||||| | |||||||
Sbjct: 322 ccctcatcgtagcagcttcggacaccaattggattaacgtttccccagtaagtctccttc 263
Query: 233 tgtggatgctcaagtggatcaccataaacttcacttgt 270
|| |||||||| || |||||||||||||| ||||||||
Sbjct: 262 tgaggatgctccagaggatcaccataaacctcacttgt 225
>gb|BE325403.2|BE325403 NF087E12ST1F1087 Developing stem Medicago truncatula cDNA clone
NF087E12ST 5', mRNA sequence
Length = 490
Score = 83.8 bits (42), Expect = 2e-014
Identities = 84/98 (85%)
Strand = Plus / Minus
Query: 173 ccctcatcataacagctcctaacaccaataggattaacgtgcccccagtatgactccttc 232
|||||||| || ||||| | |||||||| |||||||||| |||||||| | |||||||
Sbjct: 390 ccctcatcgtagcagcttcggacaccaattggattaacgtttccccagtaagtctccttc 331
Query: 233 tgtggatgctcaagtggatcaccataaacttcacttgt 270
|| |||||||| || |||||||||||||| ||||||||
Sbjct: 330 tgaggatgctccagaggatcaccataaacctcacttgt 293
>gb|BG451915.1|BG451915 NF101F03DT1F1028 Drought Medicago truncatula cDNA clone NF101F03DT
5', mRNA sequence
Length = 671
Score = 83.8 bits (42), Expect = 2e-014
Identities = 84/98 (85%)
Strand = Plus / Minus
Query: 173 ccctcatcataacagctcctaacaccaataggattaacgtgcccccagtatgactccttc 232
|||||||| || ||||| | |||||||| |||||||||| |||||||| | |||||||
Sbjct: 540 ccctcatcgtagcagcttcggacaccaattggattaacgtttccccagtaagtctccttc 481
Query: 233 tgtggatgctcaagtggatcaccataaacttcacttgt 270
|| |||||||| || |||||||||||||| ||||||||
Sbjct: 480 tgaggatgctccagaggatcaccataaacctcacttgt 443
>gb|BG647622.1|BG647622 EST509241 HOGA Medicago truncatula cDNA clone pHOGA-17M16 5' end,
mRNA sequence
Length = 710
Score = 83.8 bits (42), Expect = 2e-014
Identities = 84/98 (85%)
Strand = Plus / Minus
Query: 173 ccctcatcataacagctcctaacaccaataggattaacgtgcccccagtatgactccttc 232
|||||||| || ||||| | |||||||| |||||||||| |||||||| | |||||||
Sbjct: 390 ccctcatcgtagcagcttcggacaccaattggattaacgtttccccagtaagtctccttc 331
Query: 233 tgtggatgctcaagtggatcaccataaacttcacttgt 270
|| |||||||| || |||||||||||||| ||||||||
Sbjct: 330 tgaggatgctccagaggatcaccataaacctcacttgt 293
>gb|AC152937.21| Medicago truncatula clone mth2-96n6, complete sequence
Length = 108802
Score = 79.8 bits (40), Expect = 4e-013
Identities = 67/76 (88%)
Strand = Plus / Plus
Query: 195 caccaataggattaacgtgcccccagtatgactccttctgtggatgctcaagtggatcac 254
||||||| |||||||||| |||||||| | ||||||||| |||||||| || |||||||
Sbjct: 43494 caccaattggattaacgtttccccagtaagtctccttctgaggatgctccagaggatcac 43553
Query: 255 cataaacttcacttgt 270
||||||| ||||||||
Sbjct: 43554 cataaacctcacttgt 43569
>gb|BF004708.1|BF004708 EST433206 KV1 Medicago truncatula cDNA clone pKV1-18M2, mRNA
sequence
Length = 260
Score = 73.8 bits (37), Expect = 2e-011
Identities = 67/77 (87%)
Strand = Plus / Minus
Query: 194 acaccaataggattaacgtgcccccagtatgactccttctgtggatgctcaagtggatca 253
|||||||| |||||||||| |||||||| | ||||||||| |||||||| || ||||||
Sbjct: 206 acaccaattggattaacgtttccccagtaagtctccttctgaggatgctccagaggatca 147
Query: 254 ccataaacttcacttgt 270
||||| || ||||||||
Sbjct: 146 ccatacacctcacttgt 130
>gb|BQ139277.1|BQ139277 NF013E12PH1F1088 Phoma-infected Medicago truncatula cDNA clone
NF013E12PH 5', mRNA sequence
Length = 639
Score = 71.9 bits (36), Expect = 9e-011
Identities = 60/68 (88%)
Strand = Plus / Minus
Query: 311 cccaacatattcaaagttcccatgacatttgtcttgatcgtcttgattgggttatacttg 370
||||||||||| | || ||||| |||||||||||||| |||||||| |||||||||||
Sbjct: 617 cccaacatattaagtgtacccatcacatttgtcttgattgtcttgatagggttatactta 558
Query: 371 taatgaac 378
||||||||
Sbjct: 557 taatgaac 550
>gb|AC147012.23| Medicago truncatula clone mth2-151j16, WORKING DRAFT SEQUENCE, 2
ordered pieces
Length = 119544
Score = 61.9 bits (31), Expect = 9e-008
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 244 aagtggatcaccataaacttcacttgtgctagtcaacaaaaaccttgcaccaactcgctt 303
|||||||||||| || || |||||||| ||||||| |||||| | |||||| |||| |||
Sbjct: 67220 aagtggatcaccgtacacctcacttgtactagtcagcaaaaatcgtgcacccactctctt 67279
Query: 304 tgccagacccaacat 318
||||| ||||||||
Sbjct: 67280 tgccaatcccaacat 67294
>gb|AC174367.2| Medicago truncatula clone mth2-47m8, WORKING DRAFT SEQUENCE
Length = 76602
Score = 61.9 bits (31), Expect = 9e-008
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 244 aagtggatcaccataaacttcacttgtgctagtcaacaaaaaccttgcaccaactcgctt 303
|||||||||||| || || |||||||| ||||||| |||||| | |||||| |||| |||
Sbjct: 9367 aagtggatcaccgtacacctcacttgtactagtcagcaaaaatcgtgcacccactctctt 9308
Query: 304 tgccagacccaacat 318
||||| ||||||||
Sbjct: 9307 tgccaatcccaacat 9293
>gb|AC181973.1| Medicago truncatula clone mth2-12f6, WORKING DRAFT SEQUENCE
Length = 115891
Score = 61.9 bits (31), Expect = 9e-008
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 244 aagtggatcaccataaacttcacttgtgctagtcaacaaaaaccttgcaccaactcgctt 303
|||||||||||| || || |||||||| ||||||| |||||| | |||||| |||| |||
Sbjct: 48672 aagtggatcaccgtacacctcacttgtactagtcagcaaaaatcgtgcacccactctctt 48613
Query: 304 tgccagacccaacat 318
||||| ||||||||
Sbjct: 48612 tgccaatcccaacat 48598
>gb|AW692995.1|AW692995 NF058A10ST1F1000 Developing stem Medicago truncatula cDNA clone
NF058A10ST 5', mRNA sequence
Length = 656
Score = 44.1 bits (22), Expect = 0.021
Identities = 103/130 (79%)
Strand = Plus / Minus
Query: 280 caaaaaccttgcaccaactcgctttgccagacccaacatattcaaagttcccatgacatt 339
||||| |||||| ||||||| |||||| || || | ||| |||| ||| || || |||||
Sbjct: 139 caaaatccttgctccaactctctttgcaagcccaagcatgttcagagtgccaatcacatt 80
Query: 340 tgtcttgatcgtcttgattgggttatacttgtaatgaacgggcgacgcggggcatgcgag 399
|||||| || ||||| | || ||||| ||||| || || || ||||||||||||||
Sbjct: 79 tgtctttattgtcttcacaggattatatttgtagaaaataggagatgcggggcatgcgag 20
Query: 400 gtggtagatc 409
|||||||||
Sbjct: 19 atggtagatc 10
>gb|BE318343.1|BE318343 NF037A12LF1F1086 Developing leaf Medicago truncatula cDNA clone
NF037A12LF 5', mRNA sequence
Length = 674
Score = 44.1 bits (22), Expect = 0.021
Identities = 103/130 (79%)
Strand = Plus / Minus
Query: 280 caaaaaccttgcaccaactcgctttgccagacccaacatattcaaagttcccatgacatt 339
||||| |||||| ||||||| |||||| || || | ||| |||| ||| || || |||||
Sbjct: 486 caaaatccttgctccaactctctttgcaagcccaagcatgttcagagtgccaatcacatt 427
Query: 340 tgtcttgatcgtcttgattgggttatacttgtaatgaacgggcgacgcggggcatgcgag 399
|||||| || ||||| | || ||||| ||||| || || || ||||||||||||||
Sbjct: 426 tgtctttattgtcttcacaggattatatttgtagaaaataggagatgcggggcatgcgag 367
Query: 400 gtggtagatc 409
|||||||||
Sbjct: 366 atggtagatc 357
>gb|BG449719.1|BG449719 NF007B04IN1F1030 Insect herbivory Medicago truncatula cDNA clone
NF007B04IN 5', mRNA sequence
Length = 632
Score = 44.1 bits (22), Expect = 0.021
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 345 tgatcgtcttgattgggttatacttgtaatgaac 378
|||| |||||||| ||||||||||| ||||||||
Sbjct: 472 tgattgtcttgatagggttatacttataatgaac 439
>gb|BG454948.1|BG454948 NF111A03LF1F1018 Developing leaf Medicago truncatula cDNA clone
NF111A03LF 5', mRNA sequence
Length = 655
Score = 44.1 bits (22), Expect = 0.021
Identities = 103/130 (79%)
Strand = Plus / Minus
Query: 280 caaaaaccttgcaccaactcgctttgccagacccaacatattcaaagttcccatgacatt 339
||||| |||||| ||||||| |||||| || || | ||| |||| ||| || || |||||
Sbjct: 449 caaaatccttgctccaactctctttgcaagcccaagcatgttcagagtgccaatcacatt 390
Query: 340 tgtcttgatcgtcttgattgggttatacttgtaatgaacgggcgacgcggggcatgcgag 399
|||||| || ||||| | || ||||| ||||| || || || ||||||||||||||
Sbjct: 389 tgtctttattgtcttcacaggattatatttgtagaaaataggagatgcggggcatgcgag 330
Query: 400 gtggtagatc 409
|||||||||
Sbjct: 329 atggtagatc 320
>gb|BI309043.1|BI309043 EST530453 GPOD Medicago truncatula cDNA clone pGPOD-10B15 5' end,
mRNA sequence
Length = 661
Score = 44.1 bits (22), Expect = 0.021
Identities = 103/130 (79%)
Strand = Plus / Minus
Query: 280 caaaaaccttgcaccaactcgctttgccagacccaacatattcaaagttcccatgacatt 339
||||| |||||| ||||||| |||||| || || | ||| |||| ||| || || |||||
Sbjct: 472 caaaatccttgctccaactctctttgcaagcccaagcatgttcagagtgccaatcacatt 413
Query: 340 tgtcttgatcgtcttgattgggttatacttgtaatgaacgggcgacgcggggcatgcgag 399
|||||| || ||||| | || ||||| ||||| || || || ||||||||||||||
Sbjct: 412 tgtctttattgtcttcacaggattatatttgtagaaaataggagatgcggggcatgcgag 353
Query: 400 gtggtagatc 409
|||||||||
Sbjct: 352 atggtagatc 343
>gb|CF069593.1|CF069593 EST670314 MTUS Medicago truncatula cDNA clone MTUS-22B8, mRNA
sequence
Length = 784
Score = 44.1 bits (22), Expect = 0.021
Identities = 103/130 (79%)
Strand = Plus / Minus
Query: 280 caaaaaccttgcaccaactcgctttgccagacccaacatattcaaagttcccatgacatt 339
||||| |||||| ||||||| |||||| || || | ||| |||| ||| || || |||||
Sbjct: 715 caaaatccttgctccaactctctttgcaagcccaagcatgttcagagtgccaatcacatt 656
Query: 340 tgtcttgatcgtcttgattgggttatacttgtaatgaacgggcgacgcggggcatgcgag 399
|||||| || ||||| | || ||||| ||||| || || || ||||||||||||||
Sbjct: 655 tgtctttattgtcttcacaggattatatttgtagaaaataggagatgcggggcatgcgag 596
Query: 400 gtggtagatc 409
|||||||||
Sbjct: 595 atggtagatc 586
>gb|DW016381.1|DW016381 EST1225342 MTY Medicago truncatula cDNA clone MTYAG47, mRNA
sequence
Length = 759
Score = 44.1 bits (22), Expect = 0.021
Identities = 103/130 (79%)
Strand = Plus / Minus
Query: 280 caaaaaccttgcaccaactcgctttgccagacccaacatattcaaagttcccatgacatt 339
||||| |||||| ||||||| |||||| || || | ||| |||| ||| || || |||||
Sbjct: 507 caaaatccttgctccaactctctttgcaagcccaagcatgttcagagtgccaatcacatt 448
Query: 340 tgtcttgatcgtcttgattgggttatacttgtaatgaacgggcgacgcggggcatgcgag 399
|||||| || ||||| | || ||||| ||||| || || || ||||||||||||||
Sbjct: 447 tgtctttattgtcttcacaggattatatttgtagaaaataggagatgcggggcatgcgag 388
Query: 400 gtggtagatc 409
|||||||||
Sbjct: 387 atggtagatc 378
>gb|DW016709.1|DW016709 EST1225670 MTY Medicago truncatula cDNA clone MTYAK62, mRNA
sequence
Length = 761
Score = 44.1 bits (22), Expect = 0.021
Identities = 103/130 (79%)
Strand = Plus / Minus
Query: 280 caaaaaccttgcaccaactcgctttgccagacccaacatattcaaagttcccatgacatt 339
||||| |||||| ||||||| |||||| || || | ||| |||| ||| || || |||||
Sbjct: 446 caaaatccttgctccaactctctttgcaagcccaagcatgttcagagtgccaatcacatt 387
Query: 340 tgtcttgatcgtcttgattgggttatacttgtaatgaacgggcgacgcggggcatgcgag 399
|||||| || ||||| | || ||||| ||||| || || || ||||||||||||||
Sbjct: 386 tgtctttattgtcttcacaggattatatttgtagaaaataggagatgcggggcatgcgag 327
Query: 400 gtggtagatc 409
|||||||||
Sbjct: 326 atggtagatc 317
>gb|BG646200.1|BG646200 EST507819 KV3 Medicago truncatula cDNA clone pKV3-48D14 5' end,
mRNA sequence
Length = 661
Score = 42.1 bits (21), Expect = 0.084
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 11 gtcattggttgtcttcgtagtgcctgtgcaacaaaattgct 51
|||| ||||||| | |||| ||||||||||||||||||||
Sbjct: 602 gtcaatggttgtttgcgtatagcctgtgcaacaaaattgct 642
>gb|AW690944.1|AW690944 NF039A07ST1F1000 Developing stem Medicago truncatula cDNA clone
NF039A07ST 5', mRNA sequence
Length = 659
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 386 gcggggcatgcgaggtggtagatc 409
|||||||||||||| |||||||||
Sbjct: 623 gcggggcatgcgagatggtagatc 600
>gb|BE124847.1|BE124847 EST393882 GVN Medicago truncatula cDNA clone pGVN-68I22, mRNA
sequence
Length = 642
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 386 gcggggcatgcgaggtggtagatc 409
|||||||||||||| |||||||||
Sbjct: 627 gcggggcatgcgagatggtagatc 604
>gb|AL369577.1|AL369577 MtBA32A07F1 MtBA Medicago truncatula cDNA clone MtBA32A07 T3, mRNA
sequence
Length = 467
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 386 gcggggcatgcgaggtggtagatc 409
|||||||||||||| |||||||||
Sbjct: 371 gcggggcatgcgagatggtagatc 348
>gb|BF640544.1|BF640544 NF036F12IN1F1102 Insect herbivory Medicago truncatula cDNA clone
NF036F12IN 5', mRNA sequence
Length = 405
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 386 gcggggcatgcgaggtggtagatc 409
|||||||||||||| |||||||||
Sbjct: 387 gcggggcatgcgagatggtagatc 364
>gb|AW692447.2|AW692447 NF051E05ST1F1000 Developing stem Medicago truncatula cDNA clone
NF051E05ST 5', mRNA sequence
Length = 422
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 386 gcggggcatgcgaggtggtagatc 409
|||||||||||||| |||||||||
Sbjct: 373 gcggggcatgcgagatggtagatc 350
>gb|BI308850.1|BI308850 EST530260 GPOD Medicago truncatula cDNA clone pGPOD-8N10 5' end,
mRNA sequence
Length = 629
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 386 gcggggcatgcgaggtggtagatc 409
|||||||||||||| |||||||||
Sbjct: 80 gcggggcatgcgagatggtagatc 57
>gb|AJ499098.1|AJ499098 AJ499098 MTPOSE Medicago truncatula cDNA clone mt--acc955212b07,
mRNA sequence
Length = 542
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 386 gcggggcatgcgaggtggtagatc 409
|||||||||||||| |||||||||
Sbjct: 239 gcggggcatgcgagatggtagatc 216
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 144,424
Number of Sequences: 392609
Number of extensions: 144424
Number of successful extensions: 11251
Number of sequences better than 0.5: 27
Number of HSP's better than 0.5 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11177
Number of HSP's gapped (non-prelim): 73
length of query: 950
length of database: 441,732,993
effective HSP length: 20
effective length of query: 930
effective length of database: 433,880,813
effective search space: 403509156090
effective search space used: 403509156090
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)