BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3866402.2.1
         (406 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC152887.20|  Medicago truncatula clone mth2-91j4, WORKIN...    48   6e-004
gb|AC157648.18|  Medicago truncatula clone mth2-68d9, comple...    48   6e-004

>gb|AC152887.20| Medicago truncatula clone mth2-91j4, WORKING DRAFT SEQUENCE, 2 ordered
             pieces
          Length = 116277

 Score = 48.1 bits (24), Expect = 6e-004
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 205   ctaaatgcctgattaaaaagcaatctcgcctggaactccgagacaaatgggaacca 260
             |||||||| ||||| || ||||| | ||  ||||||||||| ||||||||||||||
Sbjct: 95825 ctaaatgcttgattgaatagcaaccgcgtttggaactccgacacaaatgggaacca 95880



>gb|AC157648.18| Medicago truncatula clone mth2-68d9, complete sequence
          Length = 84361

 Score = 48.1 bits (24), Expect = 6e-004
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 205   ctaaatgcctgattaaaaagcaatctcgcctggaactccgagacaaatgggaacca 260
             |||||||| ||||| || ||||| | ||  ||||||||||| ||||||||||||||
Sbjct: 78009 ctaaatgcttgattgaatagcaaccgcgtttggaactccgacacaaatgggaacca 77954



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 76,334
Number of Sequences: 392609
Number of extensions: 76334
Number of successful extensions: 5155
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 5152
Number of HSP's gapped (non-prelim): 3
length of query: 406
length of database: 441,732,993
effective HSP length: 19
effective length of query: 387
effective length of database: 434,273,422
effective search space: 168063814314
effective search space used: 168063814314
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)