BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3866391.2.1
         (613 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AL388988.1|AL388988  MtBC52A06F1 MtBC Medicago truncatula...    42   0.054

>gb|AL388988.1|AL388988 MtBC52A06F1 MtBC Medicago truncatula cDNA clone MtBC52A06 T3, mRNA
           sequence
          Length = 401

 Score = 42.1 bits (21), Expect = 0.054
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 14  cgtgacgctgacgctgacgctgacg 38
           ||||||||||||||||| |||||||
Sbjct: 225 cgtgacgctgacgctgaagctgacg 249




 Score = 42.1 bits (21), Expect = 0.054
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 14  cgtgacgctgacgctgacgctgacg 38
           ||||||||||||||||| |||||||
Sbjct: 120 cgtgacgctgacgctgaagctgacg 144




 Score = 40.1 bits (20), Expect = 0.21
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 14  cgtgacgctgacgctgacgc 33
           ||||||||||||||||||||
Sbjct: 192 cgtgacgctgacgctgacgc 211



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 78,957
Number of Sequences: 392609
Number of extensions: 78957
Number of successful extensions: 4578
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 4568
Number of HSP's gapped (non-prelim): 8
length of query: 613
length of database: 441,732,993
effective HSP length: 19
effective length of query: 594
effective length of database: 434,273,422
effective search space: 257958412668
effective search space used: 257958412668
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)