BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3748380.2.1
         (1272 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG940793.1|CG940793  MBEKN40TF mth2 Medicago truncatula g...    44   0.029
gb|AC146650.13|  Medicago truncatula clone mth2-14j5, comple...    44   0.029
gb|AC137823.45|  Medicago truncatula clone mth2-14c17, compl...    44   0.029
gb|AC135467.15|  Medicago truncatula clone mth2-34h12, compl...    40   0.45 
gb|AC144514.10|  Medicago truncatula clone mth2-12j2, comple...    40   0.45 
gb|DQ139345.1|  Medicago truncatula MADS box protein PIM mRN...    40   0.45 

>gb|CG940793.1|CG940793 MBEKN40TF mth2 Medicago truncatula genomic clone 75G8, DNA sequence
          Length = 943

 Score = 44.1 bits (22), Expect = 0.029
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 1156 gtttatcttgttctctatccgcttca 1181
            |||||||||||||||||||| |||||
Sbjct: 114  gtttatcttgttctctatcctcttca 139



>gb|AC146650.13| Medicago truncatula clone mth2-14j5, complete sequence
          Length = 95379

 Score = 44.1 bits (22), Expect = 0.029
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 1156  gtttatcttgttctctatccgcttca 1181
             |||||||||||||||||||| |||||
Sbjct: 25660 gtttatcttgttctctatcctcttca 25635



>gb|AC137823.45| Medicago truncatula clone mth2-14c17, complete sequence
          Length = 135139

 Score = 44.1 bits (22), Expect = 0.029
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 1156 gtttatcttgttctctatccgcttca 1181
            |||||||||||||||||||| |||||
Sbjct: 1404 gtttatcttgttctctatcctcttca 1379



>gb|AC135467.15| Medicago truncatula clone mth2-34h12, complete sequence
          Length = 114945

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 108   tttacacaaaatcacaaaccatat 131
             |||||||||||| |||||||||||
Sbjct: 55431 tttacacaaaatgacaaaccatat 55454



>gb|AC144514.10| Medicago truncatula clone mth2-12j2, complete sequence
          Length = 110255

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 108   tttacacaaaatcacaaaccatat 131
             |||||||||||| |||||||||||
Sbjct: 22892 tttacacaaaatgacaaaccatat 22869



>gb|DQ139345.1| Medicago truncatula MADS box protein PIM mRNA, complete cds
          Length = 1161

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 729 tctccttcttctgtagctcagaaattgactcg 760
           ||||||||||||| ||||| ||||| ||||||
Sbjct: 690 tctccttcttctgaagctctgaaatggactcg 659



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 297,770
Number of Sequences: 392609
Number of extensions: 297770
Number of successful extensions: 22737
Number of sequences better than  0.5: 6
Number of HSP's better than  0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22715
Number of HSP's gapped (non-prelim): 22
length of query: 1272
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1252
effective length of database: 433,880,813
effective search space: 543218777876
effective search space used: 543218777876
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)