BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3742446.2.1
         (598 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AW980342.1|AW980342  EST391495 GVN Medicago truncatula cD...    44   0.013
gb|BE124180.1|BE124180  EST394305 DSIL Medicago truncatula c...    44   0.013
gb|BF637771.1|BF637771  NF042F12PL1F1101 Phosphate starved l...    44   0.013
gb|BF640909.1|BF640909  NF059B05IN1F1044 Insect herbivory Me...    44   0.013
gb|BG453104.1|BG453104  NF087C12LF1F1087 Developing leaf Med...    44   0.013
gb|BQ124570.1|BQ124570  EST610146 GLSD Medicago truncatula c...    44   0.013
gb|CA989748.1|CA989748  EST643256 GLSD Medicago truncatula c...    44   0.013
gb|CX541042.1|CX541042  s13dNF58B06GS057_465370 Germinating ...    44   0.013
gb|CX542021.1|CX542021  s13dNF89B02GS025_467350 Germinating ...    44   0.013

>gb|AW980342.1|AW980342 EST391495 GVN Medicago truncatula cDNA clone pGVN-30E14, mRNA
           sequence
          Length = 626

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 13  caaatctctaccattatgacct 34
           ||||||||||||||||||||||
Sbjct: 275 caaatctctaccattatgacct 296



>gb|BE124180.1|BE124180 EST394305 DSIL Medicago truncatula cDNA clone pDSIL-13E14, mRNA
           sequence
          Length = 414

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 13  caaatctctaccattatgacct 34
           ||||||||||||||||||||||
Sbjct: 227 caaatctctaccattatgacct 248



>gb|BF637771.1|BF637771 NF042F12PL1F1101 Phosphate starved leaf Medicago truncatula cDNA
           clone NF042F12PL 5', mRNA sequence
          Length = 675

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 13  caaatctctaccattatgacct 34
           ||||||||||||||||||||||
Sbjct: 202 caaatctctaccattatgacct 223



>gb|BF640909.1|BF640909 NF059B05IN1F1044 Insect herbivory Medicago truncatula cDNA clone
           NF059B05IN 5', mRNA sequence
          Length = 518

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 13  caaatctctaccattatgacct 34
           ||||||||||||||||||||||
Sbjct: 494 caaatctctaccattatgacct 515



>gb|BG453104.1|BG453104 NF087C12LF1F1087 Developing leaf Medicago truncatula cDNA clone
          NF087C12LF 5', mRNA sequence
          Length = 562

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 13 caaatctctaccattatgacct 34
          ||||||||||||||||||||||
Sbjct: 74 caaatctctaccattatgacct 95



>gb|BQ124570.1|BQ124570 EST610146 GLSD Medicago truncatula cDNA clone pGLSD-35L19, mRNA
           sequence
          Length = 781

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 13  caaatctctaccattatgacct 34
           ||||||||||||||||||||||
Sbjct: 464 caaatctctaccattatgacct 485



>gb|CA989748.1|CA989748 EST643256 GLSD Medicago truncatula cDNA clone pGLSD-42L5, mRNA
           sequence
          Length = 600

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 13  caaatctctaccattatgacct 34
           ||||||||||||||||||||||
Sbjct: 81  caaatctctaccattatgacct 102



>gb|CX541042.1|CX541042 s13dNF58B06GS057_465370 Germinating Seed Medicago truncatula cDNA,
           mRNA sequence
          Length = 592

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 13  caaatctctaccattatgacct 34
           ||||||||||||||||||||||
Sbjct: 100 caaatctctaccattatgacct 121



>gb|CX542021.1|CX542021 s13dNF89B02GS025_467350 Germinating Seed Medicago truncatula cDNA,
           mRNA sequence
          Length = 563

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 13  caaatctctaccattatgacct 34
           ||||||||||||||||||||||
Sbjct: 150 caaatctctaccattatgacct 171



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 84,861
Number of Sequences: 392609
Number of extensions: 84861
Number of successful extensions: 5308
Number of sequences better than  0.5: 9
Number of HSP's better than  0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 5299
Number of HSP's gapped (non-prelim): 9
length of query: 598
length of database: 441,732,993
effective HSP length: 19
effective length of query: 579
effective length of database: 434,273,422
effective search space: 251444311338
effective search space used: 251444311338
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)