BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3712941.2.1
         (1473 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CX542314.1|CX542314  s13dNF82D03GS026_467944 Germinating ...    48   0.002
gb|BF633802.1|BF633802  NF066C10DT1F1081 Drought Medicago tr...    46   0.008
gb|BG582575.1|BG582575  EST484320 GVN Medicago truncatula cD...    46   0.008
gb|CA920234.1|CA920234  EST637952 MTUS Medicago truncatula c...    46   0.008
gb|CX530147.1|CX530147  s13dNF44H02MJ025_246329 Methyl Jasmo...    46   0.008

>gb|CX542314.1|CX542314 s13dNF82D03GS026_467944 Germinating Seed Medicago truncatula cDNA,
           mRNA sequence
          Length = 551

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 93/116 (80%)
 Strand = Plus / Plus

                                                                       
Query: 759 ccagcaaagtattttgctaagctcttacgaaaggccatgaaaggtttaggcactgatgac 818
           ||||||||||||||||| ||| | ||    ||||| |||||||||||||| ||| |||| 
Sbjct: 325 ccagcaaagtattttgcaaaggtgttgtataaggcaatgaaaggtttagggactaatgat 384

                                                                   
Query: 819 atgacacttataagggtggtggtgacgaggaccgagattgacatgcaatatatcaa 874
           |  ||||| ||||||||  | || || ||||| |||||||| ||| |||| |||||
Sbjct: 385 accacactcataagggtcatcgtaacaaggactgagattgatatgaaatacatcaa 440



>gb|BF633802.1|BF633802 NF066C10DT1F1081 Drought Medicago truncatula cDNA clone NF066C10DT
           5', mRNA sequence
          Length = 594

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                       
Query: 762 gcaaagtattttgctaagctcttacgaaaggccatgaaaggtttaggcactgatgacatg 821
           ||||||||||| || ||| || |||| ||||| ||||||||| | || || ||||||| |
Sbjct: 335 gcaaagtatttcgcgaaggtcctacgtaaggcaatgaaaggtctcgggaccgatgacacg 394

                          
Query: 822 acacttataagggtg 836
           | |||||| ||||||
Sbjct: 395 aaacttatgagggtg 409



>gb|BG582575.1|BG582575 EST484320 GVN Medicago truncatula cDNA clone pGVN-70G13 5' end,
           mRNA sequence
          Length = 725

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                       
Query: 762 gcaaagtattttgctaagctcttacgaaaggccatgaaaggtttaggcactgatgacatg 821
           ||||||||||| || ||| || |||| ||||| ||||||||| | || || ||||||| |
Sbjct: 326 gcaaagtatttcgcgaaggtcctacgtaaggcaatgaaaggtctcgggaccgatgacacg 385

                          
Query: 822 acacttataagggtg 836
           | |||||| ||||||
Sbjct: 386 aaacttatgagggtg 400



>gb|CA920234.1|CA920234 EST637952 MTUS Medicago truncatula cDNA clone MTUS-25G6, mRNA
           sequence
          Length = 740

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 762 gcaaagtattttgctaagctcttacgaaaggccatgaaaggtttaggcactgatgacatg 821
           ||||||||||| || ||| || |||| ||||| ||||||||| | || || ||||||| |
Sbjct: 401 gcaaagtatttcgcgaaggtcctacgtaaggcaatgaaaggtctcgggaccgatgacacg 342

                          
Query: 822 acacttataagggtg 836
           | |||||| ||||||
Sbjct: 341 aaacttatgagggtg 327



>gb|CX530147.1|CX530147 s13dNF44H02MJ025_246329 Methyl Jasmonate-Elicited Root Cell
           Suspension Culture Medicago truncatula cDNA, mRNA
           sequence
          Length = 636

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                       
Query: 762 gcaaagtattttgctaagctcttacgaaaggccatgaaaggtttaggcactgatgacatg 821
           ||||||||||| || ||| || |||| ||||| ||||||||| | || || ||||||| |
Sbjct: 276 gcaaagtatttcgcgaaggtcctacgtaaggcaatgaaaggtctcgggaccgatgacacg 335

                          
Query: 822 acacttataagggtg 836
           | |||||| ||||||
Sbjct: 336 aaacttatgagggtg 350



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 358,861
Number of Sequences: 392609
Number of extensions: 358861
Number of successful extensions: 26580
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26572
Number of HSP's gapped (non-prelim): 7
length of query: 1473
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1453
effective length of database: 433,880,813
effective search space: 630428821289
effective search space used: 630428821289
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)