BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3276201.2.1
         (1827 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG969898.1|CG969898  MBEDK37TFC mth2 Medicago truncatula ...    44   0.041
gb|AC146709.11|  Medicago truncatula clone mth2-90m14, compl...    42   0.16 
gb|AC174360.2|  Medicago truncatula clone mth2-31a5, WORKING...    42   0.16 

>gb|CG969898.1|CG969898 MBEDK37TFC mth2 Medicago truncatula genomic clone 32H1, DNA sequence
          Length = 746

 Score = 44.1 bits (22), Expect = 0.041
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1536 ttaattaatttcttctttattt 1557
            ||||||||||||||||||||||
Sbjct: 185  ttaattaatttcttctttattt 206



>gb|AC146709.11| Medicago truncatula clone mth2-90m14, complete sequence
          Length = 110472

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1535  tttaattaatttcttctttattttt 1559
             |||||||||||||| ||||||||||
Sbjct: 15521 tttaattaatttctgctttattttt 15497



>gb|AC174360.2| Medicago truncatula clone mth2-31a5, WORKING DRAFT SEQUENCE
          Length = 23653

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1535 tttaattaatttcttctttattttt 1559
            |||||||||||||| ||||||||||
Sbjct: 8156 tttaattaatttctgctttattttt 8180



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 321,737
Number of Sequences: 392609
Number of extensions: 321737
Number of successful extensions: 30804
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30794
Number of HSP's gapped (non-prelim): 10
length of query: 1827
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1807
effective length of database: 433,880,813
effective search space: 784022629091
effective search space used: 784022629091
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)