BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3276111.2.1
         (1393 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG934398.1|CG934398  MBEFH25TF mth2 Medicago truncatula g...    40   0.49 
gb|AC124951.19|  Medicago truncatula clone mth2-7p23, comple...    40   0.49 

>gb|CG934398.1|CG934398 MBEFH25TF mth2 Medicago truncatula genomic clone 43F2, DNA sequence
          Length = 780

 Score = 40.1 bits (20), Expect = 0.49
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1219 catatatatatacacacatg 1238
            ||||||||||||||||||||
Sbjct: 588  catatatatatacacacatg 607



>gb|AC124951.19| Medicago truncatula clone mth2-7p23, complete sequence
          Length = 124973

 Score = 40.1 bits (20), Expect = 0.49
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1221  tatatatatacacacatgaa 1240
             ||||||||||||||||||||
Sbjct: 23344 tatatatatacacacatgaa 23325



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 447,122
Number of Sequences: 392609
Number of extensions: 447122
Number of successful extensions: 15623
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15619
Number of HSP's gapped (non-prelim): 4
length of query: 1393
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1373
effective length of database: 433,880,813
effective search space: 595718356249
effective search space used: 595718356249
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)