BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115097.2.1
(987 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC146722.14| Medicago truncatula clone mth2-23c16, WORKI... 40 0.35
>gb|AC146722.14| Medicago truncatula clone mth2-23c16, WORKING DRAFT SEQUENCE, 3
unordered pieces
Length = 121936
Score = 40.1 bits (20), Expect = 0.35
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 204 cgaaagaatgaatatgcatgcatg 227
|||| |||||||||||||||||||
Sbjct: 67815 cgaaggaatgaatatgcatgcatg 67792
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 131,251
Number of Sequences: 392609
Number of extensions: 131251
Number of successful extensions: 9146
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9139
Number of HSP's gapped (non-prelim): 7
length of query: 987
length of database: 441,732,993
effective HSP length: 20
effective length of query: 967
effective length of database: 433,880,813
effective search space: 419562746171
effective search space used: 419562746171
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)