BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3071743.2.1
(586 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC135461.11| Medicago truncatula clone mth2-34f24, compl... 40 0.20
gb|AC150246.1| Medicago truncatula chromosome 2 clone mth2-... 40 0.20
gb|AC137701.25| Medicago truncatula clone mth2-35h1, comple... 40 0.20
>gb|AC135461.11| Medicago truncatula clone mth2-34f24, complete sequence
Length = 132875
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 544 tatcatgtgaagagccatctgcag 567
||||||||||| ||||||||||||
Sbjct: 29420 tatcatgtgaaaagccatctgcag 29397
>gb|AC150246.1| Medicago truncatula chromosome 2 clone mth2-4c5, *** SEQUENCING IN
PROGRESS ***, 4 ordered pieces
Length = 94212
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 544 tatcatgtgaagagccatctgcag 567
||||||||||| ||||||||||||
Sbjct: 7898 tatcatgtgaaaagccatctgcag 7921
>gb|AC137701.25| Medicago truncatula clone mth2-35h1, complete sequence
Length = 151417
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 544 tatcatgtgaagagccatctgcag 567
||||||||||| ||||||||||||
Sbjct: 135095 tatcatgtgaaaagccatctgcag 135118
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 138,517
Number of Sequences: 392609
Number of extensions: 138517
Number of successful extensions: 8652
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8640
Number of HSP's gapped (non-prelim): 12
length of query: 586
length of database: 441,732,993
effective HSP length: 19
effective length of query: 567
effective length of database: 434,273,422
effective search space: 246233030274
effective search space used: 246233030274
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)