BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3071103.2.1
(570 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF167323.1|AF167323 Medicago truncatula clone T130002g p... 70 2e-010
gb|AC148763.14| Medicago truncatula clone mth2-29o24, compl... 70 2e-010
gb|BG449009.1|BG449009 NF003G12IN1F1100 Insect herbivory Me... 68 9e-010
gb|BI269537.1|BI269537 NF004F09IR1F1078 Irradiated Medicago... 68 9e-010
gb|BQ124909.1|BQ124909 EST610485 GLSD Medicago truncatula c... 68 9e-010
gb|BQ143906.1|BQ143906 NF037F02DT1F1016 Drought Medicago tr... 68 9e-010
gb|BQ153299.1|BQ153299 NF033G05IR1F1038 Irradiated Medicago... 68 9e-010
gb|BQ155428.1|BQ155428 NF080D07IR1F1062 Irradiated Medicago... 68 9e-010
gb|BQ155812.1|BQ155812 NF084E11IR1F1087 Irradiated Medicago... 68 9e-010
gb|BQ155892.1|BQ155892 NF085D01IR1F1014 Irradiated Medicago... 68 9e-010
gb|BQ155911.1|BQ155911 NF085F02IR1F1027 Irradiated Medicago... 68 9e-010
gb|BQ156286.1|BQ156286 NF091C01IR1F1006 Irradiated Medicago... 68 9e-010
gb|BQ165638.1|BQ165638 EST611507 KVKC Medicago truncatula c... 68 9e-010
gb|CX517163.1|CX517163 s13dNF14D07VI062_398797 Virus-Infect... 68 9e-010
gb|CX517299.1|CX517299 s13dNF07C08VI066_399617 Virus-Infect... 68 9e-010
gb|CX520567.1|CX520567 s13dNF57C09VI068_448920 Virus-Infect... 68 9e-010
gb|CX523055.1|CX523055 s13dNF88B10VI089_471914 Virus-Infect... 68 9e-010
gb|AW267781.1|AW267781 EST305909 DSIR Medicago truncatula c... 60 2e-007
gb|AW560047.1|AW560047 EST315095 DSIR Medicago truncatula c... 60 2e-007
gb|AW560048.1|AW560048 EST315096 DSIR Medicago truncatula c... 60 2e-007
gb|AL382691.1|AL382691 MtBC09D09F1 MtBC Medicago truncatula... 60 2e-007
gb|BE943303.1|BE943303 EST422882 MGHG Medicago truncatula c... 60 2e-007
gb|BE997567.1|BE997567 EST429290 GVSN Medicago truncatula c... 60 2e-007
gb|BE997667.1|BE997667 EST429390 GVSN Medicago truncatula c... 60 2e-007
gb|BF637904.1|BF637904 NF029F08PL1F1073 Phosphate starved l... 60 2e-007
gb|BF638282.1|BF638282 NF053C09PL1F1068 Phosphate starved l... 60 2e-007
gb|BF650277.1|BF650277 NF087B10EC1F1079 Elicited cell cultu... 60 2e-007
gb|AW687771.2|AW687771 NF013C08RT1F1065 Developing root Med... 60 2e-007
gb|BQ152522.1|BQ152522 NF019F07IR1F1061 Irradiated Medicago... 60 2e-007
gb|BQ155216.1|BQ155216 NF077E04IR1F1035 Irradiated Medicago... 60 2e-007
gb|BQ157165.1|BQ157165 NF101F12IR1F1103 Irradiated Medicago... 60 2e-007
gb|BQ165427.1|BQ165427 EST611296 KVKC Medicago truncatula c... 60 2e-007
gb|BQ165428.1|BQ165428 EST611297 KVKC Medicago truncatula c... 60 2e-007
gb|CB892183.1|CB892183 EST649152 KV3 Medicago truncatula cD... 60 2e-007
gb|CB893707.1|CB893707 EST646499 HOGA Medicago truncatula c... 60 2e-007
gb|CB893753.1|CB893753 EST646545 HOGA Medicago truncatula c... 60 2e-007
gb|CB895070.1|CB895070 EST647862 HOGA Medicago truncatula c... 60 2e-007
gb|CX531641.1|CX531641 s13dNF80C04MJ022_257227 Methyl Jasmo... 60 2e-007
gb|DW015521.1|DW015521 EST1224482 MTY Medicago truncatula c... 60 2e-007
gb|AC121239.34| Medicago truncatula clone mth1-8p19, comple... 60 2e-007
emb|Y10373.1|MTCHITIN1 M.truncatula mRNA for chitinase 60 2e-007
emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1... 60 2e-007
gb|AJ500330.1|AJ500330 AJ500330 MTGIM Medicago truncatula c... 56 3e-006
gb|BQ153545.1|BQ153545 NF039H01IR1F1015 Irradiated Medicago... 54 1e-005
gb|CA858965.1|CA858965 EST636220 GLSD Medicago truncatula c... 50 2e-004
gb|BE942180.1|BE942180 EST421759 MGHG Medicago truncatula c... 44 0.013
gb|BQ148340.1|BQ148340 NF067B09FL1F1077 Developing flower M... 44 0.013
gb|CA921973.1|CA921973 EST639691 MTUS Medicago truncatula c... 44 0.013
gb|DW018063.1|DW018063 EST1227024 MTY Medicago truncatula c... 44 0.013
gb|AC169517.4| Medicago truncatula clone mth2-143b7, WORKIN... 44 0.013
>gb|AF167323.1|AF167323 Medicago truncatula clone T130002g putative chitinase gene, partial
cds
Length = 260
Score = 69.9 bits (35), Expect = 2e-010
Identities = 44/47 (93%)
Strand = Plus / Minus
Query: 217 tgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
|||||||| |||| |||||||||||| ||||||||||||||||||||
Sbjct: 180 tgcccgcattcgagcccaccgttgattatgttggtgatcacgccgta 134
>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence
Length = 104879
Score = 69.9 bits (35), Expect = 2e-010
Identities = 44/47 (93%)
Strand = Plus / Plus
Query: 217 tgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
|||||||| |||| |||||||||||| ||||||||||||||||||||
Sbjct: 25090 tgcccgcattcgagcccaccgttgattatgttggtgatcacgccgta 25136
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Plus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 29213 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 29262
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 235 ccgttgatgatgttggtgatcacgcc 260
|||||||| |||||||||||||||||
Sbjct: 14913 ccgttgattatgttggtgatcacgcc 14938
>gb|BG449009.1|BG449009 NF003G12IN1F1100 Insect herbivory Medicago truncatula cDNA clone
NF003G12IN 5', mRNA sequence
Length = 557
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Plus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 248 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 297
>gb|BI269537.1|BI269537 NF004F09IR1F1078 Irradiated Medicago truncatula cDNA clone
NF004F09IR 5', mRNA sequence
Length = 618
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 341 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ124909.1|BQ124909 EST610485 GLSD Medicago truncatula cDNA clone pGLSD-37H15, mRNA
sequence
Length = 783
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 769 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 720
>gb|BQ143906.1|BQ143906 NF037F02DT1F1016 Drought Medicago truncatula cDNA clone NF037F02DT
5', mRNA sequence
Length = 806
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 358 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 309
>gb|BQ153299.1|BQ153299 NF033G05IR1F1038 Irradiated Medicago truncatula cDNA clone
NF033G05IR 5', mRNA sequence
Length = 432
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 341 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ155428.1|BQ155428 NF080D07IR1F1062 Irradiated Medicago truncatula cDNA clone
NF080D07IR 5', mRNA sequence
Length = 615
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 341 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ155812.1|BQ155812 NF084E11IR1F1087 Irradiated Medicago truncatula cDNA clone
NF084E11IR 5', mRNA sequence
Length = 623
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 341 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ155892.1|BQ155892 NF085D01IR1F1014 Irradiated Medicago truncatula cDNA clone
NF085D01IR 5', mRNA sequence
Length = 629
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 341 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ155911.1|BQ155911 NF085F02IR1F1027 Irradiated Medicago truncatula cDNA clone
NF085F02IR 5', mRNA sequence
Length = 626
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 341 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ156286.1|BQ156286 NF091C01IR1F1006 Irradiated Medicago truncatula cDNA clone
NF091C01IR 5', mRNA sequence
Length = 611
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 341 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ165638.1|BQ165638 EST611507 KVKC Medicago truncatula cDNA clone pKVKC-10F8, mRNA
sequence
Length = 737
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Plus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 220 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 269
>gb|CX517163.1|CX517163 s13dNF14D07VI062_398797 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 314
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 86 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 37
>gb|CX517299.1|CX517299 s13dNF07C08VI066_399617 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 532
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 383 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 334
>gb|CX520567.1|CX520567 s13dNF57C09VI068_448920 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 530
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 381 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 332
>gb|CX523055.1|CX523055 s13dNF88B10VI089_471914 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 544
Score = 67.9 bits (34), Expect = 9e-010
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 214 ccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 263
||||||||||| |||| ||| |||||||| ||||||||||||||||||||
Sbjct: 504 ccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgta 455
>gb|AW267781.1|AW267781 EST305909 DSIR Medicago truncatula cDNA clone pDSIR-8C11, mRNA
sequence
Length = 699
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 692 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 633
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 632 gattgttgag 623
>gb|AW560047.1|AW560047 EST315095 DSIR Medicago truncatula cDNA clone pDSIR-26G13, mRNA
sequence
Length = 629
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 604 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 545
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 544 gattgttgag 535
>gb|AW560048.1|AW560048 EST315096 DSIR Medicago truncatula cDNA clone pDSIR-26G13, mRNA
sequence
Length = 738
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 681 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 622
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 621 gattgttgag 612
>gb|AL382691.1|AL382691 MtBC09D09F1 MtBC Medicago truncatula cDNA clone MtBC09D09 T3, mRNA
sequence
Length = 482
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 135 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 76
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 75 gattgttgag 66
>gb|BE943303.1|BE943303 EST422882 MGHG Medicago truncatula cDNA clone pMGHG-15I16, mRNA
sequence
Length = 583
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 126 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 67
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 66 gattgttgag 57
>gb|BE997567.1|BE997567 EST429290 GVSN Medicago truncatula cDNA clone pGVSN-1B17, mRNA
sequence
Length = 493
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 356 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 297
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 296 gattgttgag 287
>gb|BE997667.1|BE997667 EST429390 GVSN Medicago truncatula cDNA clone pGVSN-1F10, mRNA
sequence
Length = 471
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 109 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 50
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 49 gattgttgag 40
>gb|BF637904.1|BF637904 NF029F08PL1F1073 Phosphate starved leaf Medicago truncatula cDNA
clone NF029F08PL 5', mRNA sequence
Length = 642
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 526 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 467
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 466 gattgttgag 457
>gb|BF638282.1|BF638282 NF053C09PL1F1068 Phosphate starved leaf Medicago truncatula cDNA
clone NF053C09PL 5', mRNA sequence
Length = 649
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 526 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 467
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 466 gattgttgag 457
>gb|BF650277.1|BF650277 NF087B10EC1F1079 Elicited cell culture Medicago truncatula cDNA
clone NF087B10EC 5', mRNA sequence
Length = 610
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 529 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 470
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 469 gattgttgag 460
>gb|AW687771.2|AW687771 NF013C08RT1F1065 Developing root Medicago truncatula cDNA clone
NF013C08RT 5', mRNA sequence
Length = 584
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 344 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 285
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 284 gattgttgag 275
>gb|BQ152522.1|BQ152522 NF019F07IR1F1061 Irradiated Medicago truncatula cDNA clone
NF019F07IR 5', mRNA sequence
Length = 540
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 141 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 82
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 81 gattgttgag 72
>gb|BQ155216.1|BQ155216 NF077E04IR1F1035 Irradiated Medicago truncatula cDNA clone
NF077E04IR 5', mRNA sequence
Length = 396
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 338 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 279
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 278 gattgttgag 269
>gb|BQ157165.1|BQ157165 NF101F12IR1F1103 Irradiated Medicago truncatula cDNA clone
NF101F12IR 5', mRNA sequence
Length = 616
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 136 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 77
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 76 gattgttgag 67
>gb|BQ165427.1|BQ165427 EST611296 KVKC Medicago truncatula cDNA clone pKVKC-9B4, mRNA
sequence
Length = 767
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 697 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 638
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 637 gattgttgag 628
>gb|BQ165428.1|BQ165428 EST611297 KVKC Medicago truncatula cDNA clone pKVKC-9B4, mRNA
sequence
Length = 739
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 458 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 517
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 518 gattgttgag 527
>gb|CB892183.1|CB892183 EST649152 KV3 Medicago truncatula cDNA clone KV3-53O18, mRNA
sequence
Length = 811
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 666 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 607
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 606 gattgttgag 597
>gb|CB893707.1|CB893707 EST646499 HOGA Medicago truncatula cDNA clone HOGA-28D4, mRNA
sequence
Length = 810
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 598 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 539
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 538 gattgttgag 529
>gb|CB893753.1|CB893753 EST646545 HOGA Medicago truncatula cDNA clone HOGA-28L14, mRNA
sequence
Length = 783
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 600 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 541
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 540 gattgttgag 531
>gb|CB895070.1|CB895070 EST647862 HOGA Medicago truncatula cDNA clone HOGA-33B21, mRNA
sequence
Length = 532
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 356 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 297
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 296 gattgttgag 287
>gb|CX531641.1|CX531641 s13dNF80C04MJ022_257227 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 609
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 458 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 517
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 518 gattgttgag 527
>gb|DW015521.1|DW015521 EST1224482 MTY Medicago truncatula cDNA clone MTYA631, mRNA
sequence
Length = 731
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 725 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 666
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 665 gattgttgag 656
>gb|AC121239.34| Medicago truncatula clone mth1-8p19, complete sequence
Length = 100985
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 89384 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 89443
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 89444 gattgttgag 89453
>emb|Y10373.1|MTCHITIN1 M.truncatula mRNA for chitinase
Length = 1315
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 709 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 650
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 649 gattgttgag 640
>emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1H4 on chromosome 3, complete
sequence
Length = 100991
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 89381 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 89440
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 89441 gattgttgag 89450
>gb|AJ500330.1|AJ500330 AJ500330 MTGIM Medicago truncatula cDNA clone mtgmacc120015c02,
mRNA sequence
Length = 493
Score = 56.0 bits (28), Expect = 3e-006
Identities = 58/68 (85%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || || |||||||| |
Sbjct: 391 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggctacgaggtctg 332
Query: 419 ggttgttg 426
| ||||||
Sbjct: 331 gattgttg 324
>gb|BQ153545.1|BQ153545 NF039H01IR1F1015 Irradiated Medicago truncatula cDNA clone
NF039H01IR 5', mRNA sequence
Length = 352
Score = 54.0 bits (27), Expect = 1e-005
Identities = 59/70 (84%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||||||| || || |||||||||||||| || ||||| || | |||||||| |
Sbjct: 338 tcatccagaaccatagagcggtcttgaaggatataacagggtcggtggntacgaggtctg 279
Query: 419 ggttgttgag 428
| ||||||||
Sbjct: 278 gattgttgag 269
>gb|CA858965.1|CA858965 EST636220 GLSD Medicago truncatula cDNA clone pGLSD-39H17, mRNA
sequence
Length = 738
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 235 ccgttgatgatgttggtgatcacgccgta 263
|||||||| ||||||||||||||||||||
Sbjct: 732 ccgttgattatgttggtgatcacgccgta 704
>gb|BE942180.1|BE942180 EST421759 MGHG Medicago truncatula cDNA clone pMGHG-7B24, mRNA
sequence
Length = 400
Score = 44.1 bits (22), Expect = 0.013
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatat 392
||||||||||||| || || ||||||||||||||
Sbjct: 38 tcatccagaaccatagagcggtcttgaaggatat 5
>gb|BQ148340.1|BQ148340 NF067B09FL1F1077 Developing flower Medicago truncatula cDNA clone
NF067B09FL 5', mRNA sequence
Length = 669
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 235 ccgttgatgatgttggtgatcacgcc 260
|||||||| |||||||||||||||||
Sbjct: 560 ccgttgattatgttggtgatcacgcc 535
>gb|CA921973.1|CA921973 EST639691 MTUS Medicago truncatula cDNA clone MTUS-47A5, mRNA
sequence
Length = 423
Score = 44.1 bits (22), Expect = 0.013
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatat 392
||||||||||||| || || ||||||||||||||
Sbjct: 384 tcatccagaaccatagagcggtcttgaaggatat 417
>gb|DW018063.1|DW018063 EST1227024 MTY Medicago truncatula cDNA clone MTYB177, mRNA
sequence
Length = 848
Score = 44.1 bits (22), Expect = 0.013
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 231 cccaccgttgatg-atgttggtgatcacgccgta 263
|||||||||||| ||||||||||||||||||||
Sbjct: 845 cccaccgttgatttatgttggtgatcacgccgta 812
>gb|AC169517.4| Medicago truncatula clone mth2-143b7, WORKING DRAFT SEQUENCE, 8
unordered pieces
Length = 84242
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 235 ccgttgatgatgttggtgatcacgcc 260
|||||||| |||||||||||||||||
Sbjct: 37024 ccgttgattatgttggtgatcacgcc 36999
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 63,824
Number of Sequences: 392609
Number of extensions: 63824
Number of successful extensions: 5307
Number of sequences better than 0.5: 50
Number of HSP's better than 0.5 without gapping: 50
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 5211
Number of HSP's gapped (non-prelim): 96
length of query: 570
length of database: 441,732,993
effective HSP length: 19
effective length of query: 551
effective length of database: 434,273,422
effective search space: 239284655522
effective search space used: 239284655522
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)