BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3067375.2.1
(1829 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW692487.2|AW692487 NF052A09ST1F1000 Developing stem Med... 60 7e-007
gb|BM779676.1|BM779676 EST590252 KV2 Medicago truncatula cD... 60 7e-007
gb|BM779758.1|BM779758 EST590334 KV2 Medicago truncatula cD... 60 7e-007
gb|AC144657.6| Medicago truncatula clone mth2-16a6, complet... 46 0.011
gb|AC144540.6| Medicago truncatula clone mth2-19p16, comple... 46 0.011
gb|AC144404.34| Medicago truncatula clone mth2-19f21, WORKI... 46 0.011
emb|CR962133.1| Medicago truncatula chromosome 5 clone mth2... 42 0.16
>gb|AW692487.2|AW692487 NF052A09ST1F1000 Developing stem Medicago truncatula cDNA clone
NF052A09ST 5', mRNA sequence
Length = 603
Score = 60.0 bits (30), Expect = 7e-007
Identities = 72/86 (83%)
Strand = Plus / Minus
Query: 1659 gcatctgcaattgcatgctgatcatggggatcaacaaggagaccattttccagaacctga 1718
||||||||||| | ||||||||||||||||| || || |||||||| || || ||| ||
Sbjct: 527 gcatctgcaatagactgctgatcatggggatctaccagcagaccattgtcaagtacccga 468
Query: 1719 taaatttcaacaggagccccattttt 1744
| ||| ||||||||| | ||||||||
Sbjct: 467 tgaatatcaacaggaccaccattttt 442
>gb|BM779676.1|BM779676 EST590252 KV2 Medicago truncatula cDNA clone pKV2-52B16, mRNA
sequence
Length = 768
Score = 60.0 bits (30), Expect = 7e-007
Identities = 72/86 (83%)
Strand = Plus / Minus
Query: 1659 gcatctgcaattgcatgctgatcatggggatcaacaaggagaccattttccagaacctga 1718
||||||||||| | ||||||||||||||||| || || |||||||| || || ||| ||
Sbjct: 378 gcatctgcaatagactgctgatcatggggatctaccagcagaccattgtcaagtacccga 319
Query: 1719 taaatttcaacaggagccccattttt 1744
| ||| ||||||||| | ||||||||
Sbjct: 318 tgaatatcaacaggaccaccattttt 293
>gb|BM779758.1|BM779758 EST590334 KV2 Medicago truncatula cDNA clone pKV2-53A3, mRNA sequence
Length = 791
Score = 60.0 bits (30), Expect = 7e-007
Identities = 72/86 (83%)
Strand = Plus / Minus
Query: 1659 gcatctgcaattgcatgctgatcatggggatcaacaaggagaccattttccagaacctga 1718
||||||||||| | ||||||||||||||||| || || |||||||| || || ||| ||
Sbjct: 400 gcatctgcaatagactgctgatcatggggatctaccagcagaccattgtcaagtacccga 341
Query: 1719 taaatttcaacaggagccccattttt 1744
| ||| ||||||||| | ||||||||
Sbjct: 340 tgaatatcaacaggaccaccattttt 315
>gb|AC144657.6| Medicago truncatula clone mth2-16a6, complete sequence
Length = 92738
Score = 46.1 bits (23), Expect = 0.011
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 1659 gcatctgcaattgcatgctgatcatggggatcaacaaggagaccatt 1705
||||||||||| | ||||||||||||||||| || || ||||||||
Sbjct: 55165 gcatctgcaatagactgctgatcatggggatctaccagcagaccatt 55119
>gb|AC144540.6| Medicago truncatula clone mth2-19p16, complete sequence
Length = 78738
Score = 46.1 bits (23), Expect = 0.011
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 1659 gcatctgcaattgcatgctgatcatggggatcaacaaggagaccatt 1705
||||||||||| | ||||||||||||||||| || || ||||||||
Sbjct: 55677 gcatctgcaatagactgctgatcatggggatctaccagcagaccatt 55723
>gb|AC144404.34| Medicago truncatula clone mth2-19f21, WORKING DRAFT SEQUENCE, 14
unordered pieces
Length = 268915
Score = 46.1 bits (23), Expect = 0.011
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 1659 gcatctgcaattgcatgctgatcatggggatcaacaaggagaccatt 1705
||||||||||| | ||||||||||||||||| || || ||||||||
Sbjct: 129785 gcatctgcaatagactgctgatcatggggatctaccagcagaccatt 129739
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 389 tccattaacaagctcttcaat 409
|||||||||||||||||||||
Sbjct: 265317 tccattaacaagctcttcaat 265297
>emb|CR962133.1| Medicago truncatula chromosome 5 clone mth2-17h8, COMPLETE SEQUENCE
Length = 114811
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 820 accagtttcaccaacaatgac 840
|||||||||||||||||||||
Sbjct: 52587 accagtttcaccaacaatgac 52607
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 621,807
Number of Sequences: 392609
Number of extensions: 621807
Number of successful extensions: 49796
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49723
Number of HSP's gapped (non-prelim): 73
length of query: 1829
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1809
effective length of database: 433,880,813
effective search space: 784890390717
effective search space used: 784890390717
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)