BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3067043.2.1
(834 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR335836.1| mte1-66N5RM1 BAC end, cultivar Jemalong A17... 44 0.019
emb|CR295644.1| mte1-12C13FM1 BAC end, cultivar Jemalong A1... 44 0.019
emb|CR307695.1| mte1-28F22FM1 BAC end, cultivar Jemalong A1... 44 0.019
emb|CR309926.1| mte1-31C12FM1 BAC end, cultivar Jemalong A1... 44 0.019
emb|CR314649.1| mte1-38M20RM1 BAC end, cultivar Jemalong A1... 44 0.019
emb|CR315114.1| mte1-39O17FM1 BAC end, cultivar Jemalong A1... 44 0.019
emb|CR322280.1| mte1-49H21FM1 BAC end, cultivar Jemalong A1... 44 0.019
gb|AW774625.1|AW774625 EST333776 KV3 Medicago truncatula cD... 44 0.019
gb|AW775842.1|AW775842 EST334907 DSIL Medicago truncatula c... 44 0.019
gb|BF649665.1|BF649665 NF081H11EC1F1094 Elicited cell cultu... 44 0.019
gb|BI273174.1|BI273174 NF091B12FL1F1096 Developing flower M... 44 0.019
gb|CX532800.1|CX532800 s13dNF71G05MJ036_271883 Methyl Jasmo... 44 0.019
gb|CX535226.1|CX535226 s13dNF95H11MJ096_388629 Methyl Jasmo... 44 0.019
gb|AC128660.31| Medicago truncatula clone mth2-14p23, compl... 44 0.019
gb|AC124963.32| Medicago truncatula clone mth2-24f5, comple... 42 0.074
gb|AC155888.2| Medicago truncatula chromosome 7 BAC clone m... 40 0.29
gb|AC161031.11| Medicago truncatula clone mth2-65j10, WORKI... 40 0.29
>emb|CR335836.1| mte1-66N5RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 647
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 468 ggtgatgatggcaactatgcacaaac 493
>emb|CR295644.1| mte1-12C13FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 854
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 479 ggtgatgatggcaactatgcacaaac 504
>emb|CR307695.1| mte1-28F22FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 574
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 413 ggtgatgatggcaactatgcacaaac 438
>emb|CR309926.1| mte1-31C12FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 736
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 477 ggtgatgatggcaactatgcacaaac 502
>emb|CR314649.1| mte1-38M20RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 562
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 468 ggtgatgatggcaactatgcacaaac 493
>emb|CR315114.1| mte1-39O17FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 790
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 466 ggtgatgatggcaactatgcacaaac 491
>emb|CR322280.1| mte1-49H21FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 856
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 484 ggtgatgatggcaactatgcacaaac 509
>gb|AW774625.1|AW774625 EST333776 KV3 Medicago truncatula cDNA clone pKV3-23M13, mRNA
sequence
Length = 648
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 307 ggtgatgatggcaactatgcacaaac 332
>gb|AW775842.1|AW775842 EST334907 DSIL Medicago truncatula cDNA clone pDSIL-3E8, mRNA
sequence
Length = 654
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 433 ggtgatgatggcaactatgcacaaac 458
>gb|BF649665.1|BF649665 NF081H11EC1F1094 Elicited cell culture Medicago truncatula cDNA
clone NF081H11EC 5', mRNA sequence
Length = 605
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 398 ggtgatgatggcaactatgcacaaac 423
>gb|BI273174.1|BI273174 NF091B12FL1F1096 Developing flower Medicago truncatula cDNA clone
NF091B12FL 5', mRNA sequence
Length = 696
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 257 ggtgatgatggcaactatgcacaaac 282
>gb|CX532800.1|CX532800 s13dNF71G05MJ036_271883 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 666
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 351 ggtgatgatggcaactatgcacaaac 376
>gb|CX535226.1|CX535226 s13dNF95H11MJ096_388629 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 561
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 459 ggtgatgatggcaactatgcacaaac 484
>gb|AC128660.31| Medicago truncatula clone mth2-14p23, complete sequence
Length = 99170
Score = 44.1 bits (22), Expect = 0.019
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 204 ggtgatgatggcagctatgcacaaac 229
||||||||||||| ||||||||||||
Sbjct: 59806 ggtgatgatggcaactatgcacaaac 59831
>gb|AC124963.32| Medicago truncatula clone mth2-24f5, complete sequence
Length = 159515
Score = 42.1 bits (21), Expect = 0.074
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 154 caatatggaaaatgtattttgatga 178
|||||||||||||| ||||||||||
Sbjct: 122813 caatatggaaaatgcattttgatga 122837
>gb|AC155888.2| Medicago truncatula chromosome 7 BAC clone mth2-30a12, complete
sequence
Length = 104265
Score = 40.1 bits (20), Expect = 0.29
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 269 aagaattcatattggtaaat 288
||||||||||||||||||||
Sbjct: 35094 aagaattcatattggtaaat 35075
>gb|AC161031.11| Medicago truncatula clone mth2-65j10, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 102134
Score = 40.1 bits (20), Expect = 0.29
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 158 atggaaaatgtattttgatg 177
||||||||||||||||||||
Sbjct: 93127 atggaaaatgtattttgatg 93146
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 215,639
Number of Sequences: 392609
Number of extensions: 215639
Number of successful extensions: 16375
Number of sequences better than 0.5: 17
Number of HSP's better than 0.5 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16327
Number of HSP's gapped (non-prelim): 48
length of query: 834
length of database: 441,732,993
effective HSP length: 20
effective length of query: 814
effective length of database: 433,880,813
effective search space: 353178981782
effective search space used: 353178981782
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)