BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2763121.2.1
         (1190 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BE319534.2|BE319534  NF019F11RT1F1091 Developing root Med...    42   0.11 
gb|BI309940.1|BI309940  EST5311690 GESD Medicago truncatula ...    42   0.11 
gb|U16727.1|MTU16727  Medicago truncatula peroxidase precurs...    42   0.11 
gb|AC123575.10|  Medicago truncatula clone mth1-31p6, comple...    42   0.11 
emb|CR932959.2|  Medicago truncatula chromosome 5 clone mte1...    42   0.11 
gb|AC159535.5|  Medicago truncatula clone mth2-152f22, WORKI...    42   0.11 
gb|CG919883.1|CG919883  MBEFK59TR mth2 Medicago truncatula g...    40   0.42 
gb|AL385774.1|AL385774  MtBC30E10F1 MtBC Medicago truncatula...    40   0.42 

>gb|BE319534.2|BE319534 NF019F11RT1F1091 Developing root Medicago truncatula cDNA clone
           NF019F11RT 5', mRNA sequence
          Length = 313

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 909 tgatcaacatggggaacatcaagcc 933
           ||||||| |||||||||||||||||
Sbjct: 275 tgatcaagatggggaacatcaagcc 299



>gb|BI309940.1|BI309940 EST5311690 GESD Medicago truncatula cDNA clone pGESD4H23 5' end,
           mRNA sequence
          Length = 766

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 909 tgatcaacatggggaacatcaagcc 933
           ||||||| |||||||||||||||||
Sbjct: 691 tgatcaagatggggaacatcaagcc 715



>gb|U16727.1|MTU16727 Medicago truncatula peroxidase precursor (rip1) gene, complete cds
          Length = 3060

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 909  tgatcaacatggggaacatcaagcc 933
            ||||||| |||||||||||||||||
Sbjct: 2590 tgatcaagatggggaacatcaagcc 2614



>gb|AC123575.10| Medicago truncatula clone mth1-31p6, complete sequence
          Length = 83007

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 909   tgatcaacatggggaacatcaagcc 933
             ||||||| |||||||||||||||||
Sbjct: 73214 tgatcaagatggggaacatcaagcc 73190




 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 909   tgatcaacatggggaacatcaagcc 933
             ||||||| |||||||||||||||||
Sbjct: 47096 tgatcaagatggggaacatcaagcc 47072



>emb|CR932959.2| Medicago truncatula chromosome 5 clone mte1-55f11, COMPLETE SEQUENCE
          Length = 102868

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 909   tgatcaacatggggaacatcaagcc 933
             ||||||| |||||||||||||||||
Sbjct: 91886 tgatcaagatggggaacatcaagcc 91910




 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 909   tgatcaacatggggaacatcaagcc 933
             ||||||| |||||||||||||||||
Sbjct: 65768 tgatcaagatggggaacatcaagcc 65792



>gb|AC159535.5| Medicago truncatula clone mth2-152f22, WORKING DRAFT SEQUENCE, 7
             unordered pieces
          Length = 129622

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 188   cacttccacgactgcttcgtccagg 212
             |||||||||||||||||||| ||||
Sbjct: 45452 cacttccacgactgcttcgtgcagg 45476



>gb|CG919883.1|CG919883 MBEFK59TR mth2 Medicago truncatula genomic clone 44J21, DNA
           sequence
          Length = 807

 Score = 40.1 bits (20), Expect = 0.42
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 341 tgccctggtgttgtctcctgcgctgacatcct 372
           |||||||||||||| || || |||||||||||
Sbjct: 483 tgccctggtgttgtatcatgtgctgacatcct 514



>gb|AL385774.1|AL385774 MtBC30E10F1 MtBC Medicago truncatula cDNA clone MtBC30E10 T3, mRNA
           sequence
          Length = 492

 Score = 40.1 bits (20), Expect = 0.42
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 341 tgccctggtgttgtctcctgcgctgacatcct 372
           |||||||||||||| || || |||||||||||
Sbjct: 395 tgccctggtgttgtatcatgtgctgacatcct 426



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 146,761
Number of Sequences: 392609
Number of extensions: 146761
Number of successful extensions: 10744
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10729
Number of HSP's gapped (non-prelim): 15
length of query: 1190
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1170
effective length of database: 433,880,813
effective search space: 507640551210
effective search space used: 507640551210
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)