BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2623104.2.4
         (1628 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC146558.16|  Medicago truncatula clone mth2-12a23, WORKI...    44   0.037

>gb|AC146558.16| Medicago truncatula clone mth2-12a23, WORKING DRAFT SEQUENCE, 4 ordered
             pieces
          Length = 126642

 Score = 44.1 bits (22), Expect = 0.037
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 647   cccggggacagccccaacacggatggcatc 676
             ||||| |||||||||||||| |||||||||
Sbjct: 67104 cccggtgacagccccaacacagatggcatc 67075



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 350,722
Number of Sequences: 392609
Number of extensions: 350722
Number of successful extensions: 26768
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26763
Number of HSP's gapped (non-prelim): 5
length of query: 1628
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1608
effective length of database: 433,880,813
effective search space: 697680347304
effective search space used: 697680347304
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)