BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2591032.2.1
(735 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ165763.1|BQ165763 EST611632 KVKC Medicago truncatula c... 70 3e-010
gb|CA858134.1|CA858134 EST635389 GLSD Medicago truncatula c... 62 7e-008
gb|CX533662.1|CX533662 s13dNF0KC03MJ018_320475 Methyl Jasmo... 62 7e-008
gb|CX534322.1|CX534322 s13dNF0KC03MJ018_322401 Methyl Jasmo... 60 3e-007
gb|BE318401.2|BE318401 NF037H02LF1F1025 Developing leaf Med... 50 3e-004
gb|BI308545.1|BI308545 EST529955 GPOD Medicago truncatula c... 50 3e-004
gb|BQ122173.1|BQ122173 EST607749 GLSD Medicago truncatula c... 50 3e-004
gb|BE202836.1|BE202836 EST402858 KV1 Medicago truncatula cD... 44 0.016
gb|AL372911.1|AL372911 MtBA54D11R1 MtBA Medicago truncatula... 44 0.016
gb|BE323404.2|BE323404 NF003F01PL1F1011 Phosphate starved l... 44 0.016
gb|BG448346.1|BG448346 NF070C12EC1F1087 Elicited cell cultu... 44 0.016
gb|BG453827.1|BG453827 NF095C03LF1F1019 Developing leaf Med... 44 0.016
gb|BI272382.1|BI272382 NF023C12FL1F1097 Developing flower M... 44 0.016
gb|CA922543.1|CA922543 EST640261 MTUS Medicago truncatula c... 44 0.016
gb|AC141866.11| Medicago truncatula clone mth2-12p22, compl... 44 0.016
gb|CG941909.1|CG941909 MBEKP70TR mth2 Medicago truncatula g... 42 0.065
gb|BI272105.1|BI272105 NF020G11FL1F1087 Developing flower M... 42 0.065
gb|AC144723.5| Medicago truncatula clone mth2-7h1, WORKING ... 42 0.065
>gb|BQ165763.1|BQ165763 EST611632 KVKC Medicago truncatula cDNA clone pKVKC-11E5, mRNA
sequence
Length = 668
Score = 69.9 bits (35), Expect = 3e-010
Identities = 89/107 (83%)
Strand = Plus / Plus
Query: 598 agctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggccctcgcct 657
|||||||| ||||||| || || ||||||||||| || || ||||| || || ||||||
Sbjct: 498 agctcgtataagaatataccaaatgtccaccagtctacagcactgccgtgaccttcgcct 557
Query: 658 ttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacat 704
|||||||| || || |||| |||||||||||| ||||| || |||||
Sbjct: 558 ttgatgatttcaggcgccaagtactcgtgcgtgccaacaaaggacat 604
>gb|CA858134.1|CA858134 EST635389 GLSD Medicago truncatula cDNA clone pGLSD-27I3, mRNA
sequence
Length = 500
Score = 61.9 bits (31), Expect = 7e-008
Identities = 88/107 (82%)
Strand = Plus / Minus
Query: 598 agctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggccctcgcct 657
|||||||| ||||||| || || ||||||||||| || || ||||| || | ||||||
Sbjct: 220 agctcgtataagaatataccaaatgtccaccagtctacagcactgccgtgacattcgcct 161
Query: 658 ttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacat 704
|||||||| || || |||| |||||||||||| ||||| || |||||
Sbjct: 160 ttgatgatttcaggcgccaagtactcgtgcgtgccaacaaaggacat 114
>gb|CX533662.1|CX533662 s13dNF0KC03MJ018_320475 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 667
Score = 61.9 bits (31), Expect = 7e-008
Identities = 70/83 (84%)
Strand = Plus / Minus
Query: 622 gtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggccaggtac 681
||||||||||| || || ||||| || || |||||||||||||| || || |||| ||||
Sbjct: 657 gtccaccagtctacagcactgccgtgaccttcgcctttgatgatttcaggcgccaagtac 598
Query: 682 tcgtgcgtcccaacgaacgacat 704
|||||||| ||||| || |||||
Sbjct: 597 tcgtgcgtgccaacaaaggacat 575
>gb|CX534322.1|CX534322 s13dNF0KC03MJ018_322401 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 656
Score = 60.0 bits (30), Expect = 3e-007
Identities = 69/82 (84%)
Strand = Plus / Minus
Query: 623 tccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggccaggtact 682
|||||||||| || || ||||| || || |||||||||||||| || || |||| |||||
Sbjct: 656 tccaccagtctacagcactgccgtgaccttcgcctttgatgatttcaggcgccaagtact 597
Query: 683 cgtgcgtcccaacgaacgacat 704
||||||| ||||| || |||||
Sbjct: 596 cgtgcgtgccaacaaaggacat 575
>gb|BE318401.2|BE318401 NF037H02LF1F1025 Developing leaf Medicago truncatula cDNA clone
NF037H02LF 5', mRNA sequence
Length = 485
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 652 tcgcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacat 704
|||||||||||||| || || |||| |||||||||||| ||||| || |||||
Sbjct: 439 tcgcctttgatgatttcaggcgccaagtactcgtgcgtgccaacaaaggacat 387
>gb|BI308545.1|BI308545 EST529955 GPOD Medicago truncatula cDNA clone pGPOD-7M21 5' end,
mRNA sequence
Length = 766
Score = 50.1 bits (25), Expect = 3e-004
Identities = 145/185 (78%)
Strand = Plus / Minus
Query: 526 agctgctggccaatgacattgaacagcgtggcccggttgctggatcccttgaaaggcgtc 585
|||||||| |||| |||||||||||||| || ||||| | ||||| |||||||| ||
Sbjct: 475 agctgctgcccaactacattgaacagcgtagctcggtttcctgatcctttgaaaggtgtt 416
Query: 586 ttcccgaacagcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgcca 645
|| || ||| | ||||| |||||| | ||||| |||||||| || || || || |||
Sbjct: 415 ttaccatacaataactcgtgcaagaaaattccgaatgtccaccaatcaactgcacttcca 356
Query: 646 tggccctcgcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacatc 705
|| || || |||||||| || || ||||| || ||||| || || |||||||| |||||
Sbjct: 355 tgaccttctcctttgataatttcaggggcgagatactcatgagtaccaacgaaggacatt 296
Query: 706 gaccg 710
|||||
Sbjct: 295 gaccg 291
>gb|BQ122173.1|BQ122173 EST607749 GLSD Medicago truncatula cDNA clone pGLSD-28M11, mRNA
sequence
Length = 724
Score = 50.1 bits (25), Expect = 3e-004
Identities = 145/185 (78%)
Strand = Plus / Minus
Query: 526 agctgctggccaatgacattgaacagcgtggcccggttgctggatcccttgaaaggcgtc 585
|||||||| |||| |||||||||||||| || ||||| | ||||| |||||||| ||
Sbjct: 576 agctgctgcccaactacattgaacagcgtagctcggtttcctgatcctttgaaaggtgtt 517
Query: 586 ttcccgaacagcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgcca 645
|| || ||| | ||||| |||||| | ||||| |||||||| || || || || |||
Sbjct: 516 ttaccatacaataactcgtgcaagaaaattccgaatgtccaccaatcaactgcacttcca 457
Query: 646 tggccctcgcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacatc 705
|| || || |||||||| || || ||||| || ||||| || || |||||||| |||||
Sbjct: 456 tgaccttctcctttgataatttcaggggcgagatactcatgagtaccaacgaaggacatt 397
Query: 706 gaccg 710
|||||
Sbjct: 396 gaccg 392
>gb|BE202836.1|BE202836 EST402858 KV1 Medicago truncatula cDNA clone pKV1-3M24, mRNA
sequence
Length = 540
Score = 44.1 bits (22), Expect = 0.016
Identities = 88/110 (80%)
Strand = Plus / Plus
Query: 379 gcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtag 438
|||||||||||||| ||||| |||||||| || || ||||| || || || | || ||
Sbjct: 336 gcccaattcacgccttcaaaaaagggatgttgtttaatctcggttgcgcctcttttataa 395
Query: 439 gccagccgttgctggggctccttcacaagcagacccctgatcagatccct 488
|||| | ||||| || ||||| ||||||| ||||||||| ||||||||
Sbjct: 396 gccaatctgtgctgaggttcctttacaagcaaacccctgataagatccct 445
>gb|AL372911.1|AL372911 MtBA54D11R1 MtBA Medicago truncatula cDNA clone MtBA54D11 T7, mRNA
sequence
Length = 534
Score = 44.1 bits (22), Expect = 0.016
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 379 gcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtag 438
|||||||||||||| ||||| |||||||| || || ||||| || || || | || ||
Sbjct: 140 gcccaattcacgccttcaaaaaagggatgttgtttaatctcggttgcgcctcttttataa 81
Query: 439 gccagccgttgctggggctccttcacaagcagacccctgatcagatccct 488
|||| | ||||| || ||||| ||||||| ||||||||| ||||||||
Sbjct: 80 gccaatctgtgctgaggttcctttacaagcaaacccctgataagatccct 31
>gb|BE323404.2|BE323404 NF003F01PL1F1011 Phosphate starved leaf Medicago truncatula cDNA
clone NF003F01PL 5', mRNA sequence
Length = 296
Score = 44.1 bits (22), Expect = 0.016
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 643 ccatggccctcgcctttgatgatctcgggggccaggta 680
||||| ||||| ||||||||||||||||| || |||||
Sbjct: 248 ccatgtccctctcctttgatgatctcgggagctaggta 211
>gb|BG448346.1|BG448346 NF070C12EC1F1087 Elicited cell culture Medicago truncatula cDNA
clone NF070C12EC 5', mRNA sequence
Length = 541
Score = 44.1 bits (22), Expect = 0.016
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 643 ccatggccctcgcctttgatgatctcgggggccaggta 680
||||| ||||| ||||||||||||||||| || |||||
Sbjct: 451 ccatgtccctctcctttgatgatctcgggagctaggta 414
>gb|BG453827.1|BG453827 NF095C03LF1F1019 Developing leaf Medicago truncatula cDNA clone
NF095C03LF 5', mRNA sequence
Length = 561
Score = 44.1 bits (22), Expect = 0.016
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 379 gcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtag 438
|||||||||||||| ||||| |||||||| || || ||||| || || || | || ||
Sbjct: 247 gcccaattcacgccttcaaaaaagggatgttgtttaatctcggttgcgcctcttttataa 188
Query: 439 gccagccgttgctggggctccttcacaagcagacccctgatcagatccct 488
|||| | ||||| || ||||| ||||||| ||||||||| ||||||||
Sbjct: 187 gccaatctgtgctgaggttcctttacaagcaaacccctgataagatccct 138
>gb|BI272382.1|BI272382 NF023C12FL1F1097 Developing flower Medicago truncatula cDNA clone
NF023C12FL 5', mRNA sequence
Length = 652
Score = 44.1 bits (22), Expect = 0.016
Identities = 88/110 (80%)
Strand = Plus / Minus
Query: 379 gcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtag 438
|||||||||||||| ||||| |||||||| || || ||||| || || || | || ||
Sbjct: 468 gcccaattcacgccttcaaaaaagggatgttgtttaatctcggttgcgcctcttttataa 409
Query: 439 gccagccgttgctggggctccttcacaagcagacccctgatcagatccct 488
|||| | ||||| || ||||| ||||||| ||||||||| ||||||||
Sbjct: 408 gccaatctgtgctgaggttcctttacaagcaaacccctgataagatccct 359
>gb|CA922543.1|CA922543 EST640261 MTUS Medicago truncatula cDNA clone MTUS-55A10, mRNA
sequence
Length = 751
Score = 44.1 bits (22), Expect = 0.016
Identities = 88/110 (80%)
Strand = Plus / Plus
Query: 379 gcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtag 438
|||||||||||||| ||||| |||||||| || || ||||| || || || | || ||
Sbjct: 297 gcccaattcacgccttcaaaaaagggatgttgtttaatctcggttgcgcctcttttataa 356
Query: 439 gccagccgttgctggggctccttcacaagcagacccctgatcagatccct 488
|||| | ||||| || ||||| ||||||| ||||||||| ||||||||
Sbjct: 357 gccaatctgtgctgaggttcctttacaagcaaacccctgataagatccct 406
>gb|AC141866.11| Medicago truncatula clone mth2-12p22, complete sequence
Length = 126907
Score = 44.1 bits (22), Expect = 0.016
Identities = 88/110 (80%)
Strand = Plus / Plus
Query: 379 gcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtag 438
|||||||||||||| ||||| |||||||| || || ||||| || || || | || ||
Sbjct: 34381 gcccaattcacgccttcaaaaaagggatgttgtttaatctcggttgcgcctcttttataa 34440
Query: 439 gccagccgttgctggggctccttcacaagcagacccctgatcagatccct 488
|||| | ||||| || ||||| ||||||| ||||||||| ||||||||
Sbjct: 34441 gccaatctgtgctgaggttcctttacaagcaaacccctgataagatccct 34490
>gb|CG941909.1|CG941909 MBEKP70TR mth2 Medicago truncatula genomic clone 75L20, DNA
sequence
Length = 967
Score = 42.1 bits (21), Expect = 0.065
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 379 gcccaattcacgccctcaaagaagggatg 407
|||||||||||||| ||||| ||||||||
Sbjct: 846 gcccaattcacgccttcaaaaaagggatg 874
>gb|BI272105.1|BI272105 NF020G11FL1F1087 Developing flower Medicago truncatula cDNA clone
NF020G11FL 5', mRNA sequence
Length = 645
Score = 42.1 bits (21), Expect = 0.065
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 616 ccgaaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctc 668
||||| |||||||| || || ||| | ||||| ||||||| ||||||||||||
Sbjct: 255 ccgaaagtccaccaatctacagcgtttccatgtccctcgcttttgatgatctc 203
>gb|AC144723.5| Medicago truncatula clone mth2-7h1, WORKING DRAFT SEQUENCE, 18
unordered pieces
Length = 64100
Score = 42.1 bits (21), Expect = 0.065
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 616 ccgaaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctc 668
||||| |||||||| || || ||| | ||||| ||||||| ||||||||||||
Sbjct: 51075 ccgaaagtccaccaatctacagcgtttccatgtccctcgcttttgatgatctc 51023
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 139,107
Number of Sequences: 392609
Number of extensions: 139107
Number of successful extensions: 11663
Number of sequences better than 0.5: 18
Number of HSP's better than 0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11632
Number of HSP's gapped (non-prelim): 31
length of query: 735
length of database: 441,732,993
effective HSP length: 19
effective length of query: 716
effective length of database: 434,273,422
effective search space: 310939770152
effective search space used: 310939770152
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)