BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2494085.2.2
         (660 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC169175.1|  Medicago truncatula chromosome 2 clone mth2-...    42   0.058
gb|AC153349.20|  Medicago truncatula clone mth2-72p9, WORKIN...    40   0.23 
gb|AC161789.7|  Medicago truncatula clone mth2-116a3, WORKIN...    40   0.23 

>gb|AC169175.1| Medicago truncatula chromosome 2 clone mth2-176l12, *** SEQUENCING IN
             PROGRESS ***, 10 ordered pieces
          Length = 135339

 Score = 42.1 bits (21), Expect = 0.058
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 5     tatttaatattttaattcattaact 29
             ||||| |||||||||||||||||||
Sbjct: 63636 tattttatattttaattcattaact 63612



>gb|AC153349.20| Medicago truncatula clone mth2-72p9, WORKING DRAFT SEQUENCE, 2
            ordered pieces
          Length = 104337

 Score = 40.1 bits (20), Expect = 0.23
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    tattatttaatattttaatt 21
            ||||||||||||||||||||
Sbjct: 2647 tattatttaatattttaatt 2628



>gb|AC161789.7| Medicago truncatula clone mth2-116a3, WORKING DRAFT SEQUENCE, 15
             unordered pieces
          Length = 75506

 Score = 40.1 bits (20), Expect = 0.23
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     tattatttaatattttaatt 21
             ||||||||||||||||||||
Sbjct: 31101 tattatttaatattttaatt 31082



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 151,995
Number of Sequences: 392609
Number of extensions: 151995
Number of successful extensions: 13291
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13273
Number of HSP's gapped (non-prelim): 18
length of query: 660
length of database: 441,732,993
effective HSP length: 19
effective length of query: 641
effective length of database: 434,273,422
effective search space: 278369263502
effective search space used: 278369263502
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)