BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2493645.2.1
(870 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW299076.1|AW299076 EST305750 KV2 Medicago truncatula cD... 46 0.005
gb|BQ255167.1|BQ255167 MTNAH08TKM KVKC Medicago truncatula ... 46 0.005
gb|CA919576.1|CA919576 EST637294 MTUS Medicago truncatula c... 46 0.005
gb|AC146747.7| Medicago truncatula clone mth2-14h5, complet... 46 0.005
gb|AC165135.20| Medicago truncatula clone mth2-20f2, WORKIN... 46 0.005
gb|CG937914.1|CG937914 MBEHO73TR mth2 Medicago truncatula g... 44 0.019
gb|CG950087.1|CG950087 MBEKM05TR mth2 Medicago truncatula g... 44 0.019
gb|CG957658.1|CG957658 MBEEE62TR mth2 Medicago truncatula g... 44 0.019
emb|CR479976.1| mth2-190L1RM1 BAC end, cultivar Jemalong A1... 44 0.019
gb|AW980725.1|AW980725 EST391878 GVN Medicago truncatula cD... 44 0.019
gb|AW980810.1|AW980810 EST391963 GVN Medicago truncatula cD... 44 0.019
gb|CF069294.1|CF069294 EST670015 MTUS Medicago truncatula c... 44 0.019
gb|AC144539.7| Medicago truncatula clone mth2-11o10, comple... 44 0.019
gb|AC152185.1| Medicago truncatula chromosome 2 BAC clone m... 44 0.019
gb|AC124965.18| Medicago truncatula clone mth2-7h21, comple... 44 0.019
gb|AC150743.10| Medicago truncatula clone mth2-145c18, WORK... 44 0.019
emb|CR955004.2| Medicago truncatula chromosome 5 clone mte1... 44 0.019
emb|CT573020.1| Medicago truncatula chromosome 5 clone mth2... 44 0.019
gb|AC174325.5| Medicago truncatula clone mth2-16p19, WORKIN... 44 0.019
emb|CT030243.7| Medicago truncatula chromosome 3 clone MTH2... 44 0.019
gb|AC150743.11| Medicago truncatula clone mth2-145c18, WORK... 44 0.019
gb|AC149135.2| Medicago truncatula chromosome 2 BAC clone m... 42 0.077
emb|CR955009.1| Medicago truncatula chromosome 5 clone mth2... 42 0.077
gb|AC169179.4| Medicago truncatula chromosome 2 clone mth2-... 42 0.077
emb|CR334662.1| mte1-65A21RM1 BAC end, cultivar Jemalong A1... 40 0.30
emb|CR335388.1| mte1-66E13RM1 BAC end, cultivar Jemalong A1... 40 0.30
emb|CR338554.1| mte1-7J2FM1 BAC end, cultivar Jemalong A17 ... 40 0.30
emb|CR341425.1| mte1-73B12FM1 BAC end, cultivar Jemalong A1... 40 0.30
emb|CR307181.1| mte1-28C5FM1 BAC end, cultivar Jemalong A17... 40 0.30
emb|CR310308.1| mte1-31J4FM1 BAC end, cultivar Jemalong A17... 40 0.30
gb|AC142507.13| Medicago truncatula clone mth2-30h19, compl... 40 0.30
gb|AC142096.25| Medicago truncatula clone mth2-6m16, comple... 40 0.30
emb|CR932964.2| Medicago truncatula chromosome 5 clone mte1... 40 0.30
gb|AC144765.19| Medicago truncatula clone mth2-35o11, compl... 40 0.30
gb|AC160957.5| Medicago truncatula clone mth2-32b23, WORKIN... 40 0.30
gb|AC153162.5| Medicago truncatula clone mth2-58d22, WORKIN... 40 0.30
gb|AC152497.21| Medicago truncatula clone mth2-36l14, WORKI... 40 0.30
>gb|AW299076.1|AW299076 EST305750 KV2 Medicago truncatula cDNA clone KV2-12A12, mRNA
sequence
Length = 680
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 661 ctattattactactactactact 683
|||||||||||||||||||||||
Sbjct: 521 ctattattactactactactact 543
>gb|BQ255167.1|BQ255167 MTNAH08TKM KVKC Medicago truncatula cDNA clone pKVKC-8A8, mRNA
sequence
Length = 798
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 661 ctattattactactactactact 683
|||||||||||||||||||||||
Sbjct: 562 ctattattactactactactact 584
>gb|CA919576.1|CA919576 EST637294 MTUS Medicago truncatula cDNA clone MTUS-15C12, mRNA
sequence
Length = 756
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 661 ctattattactactactactact 683
|||||||||||||||||||||||
Sbjct: 91 ctattattactactactactact 69
>gb|AC146747.7| Medicago truncatula clone mth2-14h5, complete sequence
Length = 129204
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 661 ctattattactactactactact 683
|||||||||||||||||||||||
Sbjct: 72837 ctattattactactactactact 72859
>gb|AC165135.20| Medicago truncatula clone mth2-20f2, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 136477
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactactc 684
|||||||||||||||||||||||
Sbjct: 83636 tattattactactactactactc 83658
>gb|CG937914.1|CG937914 MBEHO73TR mth2 Medicago truncatula genomic clone 57N1, DNA sequence
Length = 891
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 527 tattattactactactactact 548
>gb|CG950087.1|CG950087 MBEKM05TR mth2 Medicago truncatula genomic clone 75A9, DNA sequence
Length = 964
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 778 tattattactactactactact 757
>gb|CG957658.1|CG957658 MBEEE62TR mth2 Medicago truncatula genomic clone 37K3, DNA sequence
Length = 685
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 418 tattattactactactactact 439
>emb|CR479976.1| mth2-190L1RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 580
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 150 tattattactactactactact 129
>gb|AW980725.1|AW980725 EST391878 GVN Medicago truncatula cDNA clone pGVN-58D13, mRNA
sequence
Length = 629
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 604 tattattactactactactact 625
>gb|AW980810.1|AW980810 EST391963 GVN Medicago truncatula cDNA clone pGVN-58D22, mRNA
sequence
Length = 623
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 600 tattattactactactactact 621
>gb|CF069294.1|CF069294 EST670015 MTUS Medicago truncatula cDNA clone MTUS-18F9, mRNA
sequence
Length = 602
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 578 tattattactactactactact 599
>gb|AC144539.7| Medicago truncatula clone mth2-11o10, complete sequence
Length = 113167
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 26117 tattattactactactactact 26138
>gb|AC152185.1| Medicago truncatula chromosome 2 BAC clone mth2-97e5, complete sequence
Length = 132467
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 126901 tattattactactactactact 126922
>gb|AC124965.18| Medicago truncatula clone mth2-7h21, complete sequence
Length = 122160
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 95368 tattattactactactactact 95347
>gb|AC150743.10| Medicago truncatula clone mth2-145c18, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 134183
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 119901 tattattactactactactact 119880
>emb|CR955004.2| Medicago truncatula chromosome 5 clone mte1-9e19, WORKING DRAFT SEQUENCE
Length = 116493
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 103607 tattattactactactactact 103586
>emb|CT573020.1| Medicago truncatula chromosome 5 clone mth2-83i12, COMPLETE SEQUENCE
Length = 92109
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 10074 tattattactactactactact 10053
>gb|AC174325.5| Medicago truncatula clone mth2-16p19, WORKING DRAFT SEQUENCE, 14
unordered pieces
Length = 111570
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 12649 tattattactactactactact 12628
>emb|CT030243.7| Medicago truncatula chromosome 3 clone MTH2-72K5, WORKING DRAFT
SEQUENCE
Length = 111034
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 82398 tattattactactactactact 82419
>gb|AC150743.11| Medicago truncatula clone mth2-145c18, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 134188
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactactact 683
||||||||||||||||||||||
Sbjct: 119906 tattattactactactactact 119885
>gb|AC149135.2| Medicago truncatula chromosome 2 BAC clone mth2-31g23, complete
sequence
Length = 113812
Score = 42.1 bits (21), Expect = 0.077
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 261 tcctcttcttcctcgtcctcctcct 285
|||||||||||||| ||||||||||
Sbjct: 77061 tcctcttcttcctcctcctcctcct 77085
>emb|CR955009.1| Medicago truncatula chromosome 5 clone mth2-38i20, COMPLETE SEQUENCE
Length = 123473
Score = 42.1 bits (21), Expect = 0.077
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 664 ttattactactactactactc 684
|||||||||||||||||||||
Sbjct: 13290 ttattactactactactactc 13270
>gb|AC169179.4| Medicago truncatula chromosome 2 clone mth2-39k10, *** SEQUENCING IN
PROGRESS ***, 5 ordered pieces
Length = 111508
Score = 42.1 bits (21), Expect = 0.077
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 663 attattactactactactact 683
|||||||||||||||||||||
Sbjct: 77733 attattactactactactact 77753
>emb|CR334662.1| mte1-65A21RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 653
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactacta 681
||||||||||||||||||||
Sbjct: 576 tattattactactactacta 557
>emb|CR335388.1| mte1-66E13RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 717
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 664 ttattactactactactact 683
||||||||||||||||||||
Sbjct: 717 ttattactactactactact 698
>emb|CR338554.1| mte1-7J2FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 539
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactacta 681
||||||||||||||||||||
Sbjct: 259 tattattactactactacta 240
>emb|CR341425.1| mte1-73B12FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 507
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 524 tcattccttcgctccctccg 543
||||||||||||||||||||
Sbjct: 158 tcattccttcgctccctccg 139
>emb|CR307181.1| mte1-28C5FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 824
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactacta 681
||||||||||||||||||||
Sbjct: 330 tattattactactactacta 311
>emb|CR310308.1| mte1-31J4FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 661
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactacta 681
||||||||||||||||||||
Sbjct: 587 tattattactactactacta 568
>gb|AC142507.13| Medicago truncatula clone mth2-30h19, complete sequence
Length = 117666
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 662 tattattactactactacta 681
||||||||||||||||||||
Sbjct: 35550 tattattactactactacta 35531
>gb|AC142096.25| Medicago truncatula clone mth2-6m16, complete sequence
Length = 129053
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactacta 681
||||||||||||||||||||
Sbjct: 116107 tattattactactactacta 116126
>emb|CR932964.2| Medicago truncatula chromosome 5 clone mte1-60l18, COMPLETE SEQUENCE
Length = 93777
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 662 tattattactactactacta 681
||||||||||||||||||||
Sbjct: 34811 tattattactactactacta 34830
>gb|AC144765.19| Medicago truncatula clone mth2-35o11, complete sequence
Length = 130836
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 660 gctattattactactactactact 683
|||||||||||||||||| |||||
Sbjct: 44313 gctattattactactactgctact 44336
>gb|AC160957.5| Medicago truncatula clone mth2-32b23, WORKING DRAFT SEQUENCE, 21
unordered pieces
Length = 132682
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 524 tcattccttcgctccctccg 543
||||||||||||||||||||
Sbjct: 116855 tcattccttcgctccctccg 116874
>gb|AC153162.5| Medicago truncatula clone mth2-58d22, WORKING DRAFT SEQUENCE, 48
unordered pieces
Length = 164332
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 524 tcattccttcgctccctccg 543
||||||||||||||||||||
Sbjct: 65606 tcattccttcgctccctccg 65587
>gb|AC152497.21| Medicago truncatula clone mth2-36l14, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 130349
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 524 tcattccttcgctccctccg 543
||||||||||||||||||||
Sbjct: 85753 tcattccttcgctccctccg 85734
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 144,886
Number of Sequences: 392609
Number of extensions: 144886
Number of successful extensions: 10902
Number of sequences better than 0.5: 37
Number of HSP's better than 0.5 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10709
Number of HSP's gapped (non-prelim): 171
length of query: 870
length of database: 441,732,993
effective HSP length: 20
effective length of query: 850
effective length of database: 433,880,813
effective search space: 368798691050
effective search space used: 368798691050
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)