BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2493528.2.1
         (627 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG935049.1|CG935049  MBEHU72TF mth2 Medicago truncatula g...    50   2e-004
gb|BI307906.1|BI307906  EST529316 GPOD Medicago truncatula c...    50   2e-004

>gb|CG935049.1|CG935049 MBEHU72TF mth2 Medicago truncatula genomic clone 59K23, DNA
           sequence
          Length = 788

 Score = 50.1 bits (25), Expect = 2e-004
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 94  ttgatctctccaattatatacactggtcttccatcaaaaacagacgacagtgtcgactca 153
           |||||||| ||||||||||  ||||| ||||||||||| |  || || |||||   ||||
Sbjct: 703 ttgatctccccaattatattaactggccttccatcaaacatggatgaaagtgtactctca 644

                                        
Query: 154 cacagcttctttagttcccttgtttttgt 182
           ||||| || || |||||| ||||||||||
Sbjct: 643 cacagttttttcagttcctttgtttttgt 615



>gb|BI307906.1|BI307906 EST529316 GPOD Medicago truncatula cDNA clone pGPOD-1E14 5' end,
           mRNA sequence
          Length = 639

 Score = 50.1 bits (25), Expect = 2e-004
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 94  ttgatctctccaattatatacactggtcttccatcaaaaacagacgacagtgtcgactca 153
           |||||||| ||||||||||  ||||| ||||||||||| |  || || |||||   ||||
Sbjct: 287 ttgatctccccaattatattaactggccttccatcaaacatggatgaaagtgtactctca 346

                                        
Query: 154 cacagcttctttagttcccttgtttttgt 182
           ||||| || || |||||| ||||||||||
Sbjct: 347 cacagttttttcagttcctttgtttttgt 375



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 205,330
Number of Sequences: 392609
Number of extensions: 205330
Number of successful extensions: 15625
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15623
Number of HSP's gapped (non-prelim): 2
length of query: 627
length of database: 441,732,993
effective HSP length: 19
effective length of query: 608
effective length of database: 434,273,422
effective search space: 264038240576
effective search space used: 264038240576
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)