BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2455940.2.1
(1115 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AA660318.1|AA660318 00189 MtRHE Medicago truncatula cDNA... 52 1e-004
gb|AI974778.1|AI974778 T113251e KV2 Medicago truncatula cDN... 52 1e-004
gb|AW256836.1|AW256836 EST304973 KV2 Medicago truncatula cD... 52 1e-004
gb|AW257069.1|AW257069 EST305206 KV2 Medicago truncatula cD... 52 1e-004
gb|AW559274.1|AW559274 EST306110 DSIR Medicago truncatula c... 52 1e-004
gb|AW684885.1|AW684885 NF022F07NR1F1000 Nodulated root Medi... 52 1e-004
gb|AW690185.1|AW690185 NF029D09ST1F1000 Developing stem Med... 52 1e-004
gb|AW695080.1|AW695080 NF091D11ST1F1093 Developing stem Med... 52 1e-004
gb|AW775400.1|AW775400 EST334465 DSIL Medicago truncatula c... 52 1e-004
gb|AW776435.1|AW776435 EST335500 DSIL Medicago truncatula c... 52 1e-004
gb|BE202817.1|BE202817 EST402839 KV1 Medicago truncatula cD... 52 1e-004
gb|BE203346.1|BE203346 EST403368 KV1 Medicago truncatula cD... 52 1e-004
gb|BE203574.1|BE203574 EST396250 KV0 Medicago truncatula cD... 52 1e-004
gb|BE205077.1|BE205077 EST397753 KV0 Medicago truncatula cD... 52 1e-004
gb|AL368320.1|AL368320 MtBA23G02F1 MtBA Medicago truncatula... 52 1e-004
gb|AL372979.1|AL372979 MtBA54H07F1 MtBA Medicago truncatula... 52 1e-004
gb|AL373431.1|AL373431 MtBA57G08F1 MtBA Medicago truncatula... 52 1e-004
gb|AL379484.1|AL379484 MtBB45F04F1 MtBB Medicago truncatula... 52 1e-004
gb|AL380137.1|AL380137 MtBB50F08F1 MtBB Medicago truncatula... 52 1e-004
gb|BE998217.1|BE998217 EST429940 GVSN Medicago truncatula c... 52 1e-004
gb|BE998654.1|BE998654 EST430377 GVSN Medicago truncatula c... 52 1e-004
gb|BF005451.1|BF005451 EST433949 DSLC Medicago truncatula c... 52 1e-004
gb|BF519321.1|BF519321 EST456783 DSIL Medicago truncatula c... 52 1e-004
gb|BF519907.1|BF519907 EST457372 DSIL Medicago truncatula c... 52 1e-004
gb|BF520898.1|BF520898 EST458371 DSIL Medicago truncatula c... 52 1e-004
gb|BF634788.1|BF634788 NF069G09DT1F1071 Drought Medicago tr... 52 1e-004
gb|BF635750.1|BF635750 NF040F09DT1F1076 Drought Medicago tr... 52 1e-004
gb|BF636068.1|BF636068 NF069E08DT1F1066 Drought Medicago tr... 52 1e-004
gb|BF636493.1|BF636493 NF088G06DT1F1051 Drought Medicago tr... 52 1e-004
gb|BF642362.1|BF642362 NF051D11IN1F1093 Insect herbivory Me... 52 1e-004
gb|BF649045.1|BF649045 NF052B03EC1F1027 Elicited cell cultu... 52 1e-004
gb|AW695176.2|AW695176 NF092D12ST1F1101 Developing stem Med... 52 1e-004
gb|BE316596.2|BE316596 NF057C11LF1F1082 Developing leaf Med... 52 1e-004
gb|BE322493.2|BE322493 NF008D09IN1F1075 Insect herbivory Me... 52 1e-004
gb|BE248039.2|BE248039 NF002H01DT1F1012 Drought Medicago tr... 52 1e-004
gb|BG448465.1|BG448465 NF036C01RT1F1002 Developing root Med... 52 1e-004
gb|BG450822.1|BG450822 NF093D04DT1F1032 Drought Medicago tr... 52 1e-004
gb|BG453059.1|BG453059 NF089H11LF1F1093 Developing leaf Med... 52 1e-004
gb|BG453560.1|BG453560 NF096D07LF1F1059 Developing leaf Med... 52 1e-004
gb|BG453602.1|BG453602 NF098F01LF1F1011 Developing leaf Med... 52 1e-004
gb|BG646445.1|BG646445 EST508064 HOGA Medicago truncatula c... 52 1e-004
gb|BI270143.1|BI270143 NF052B07FL1F1061 Developing flower M... 52 1e-004
gb|BI308179.1|BI308179 EST529589 GPOD Medicago truncatula c... 52 1e-004
gb|BI308339.1|BI308339 EST529749 GPOD Medicago truncatula c... 52 1e-004
gb|BI308775.1|BI308775 EST530185 GPOD Medicago truncatula c... 52 1e-004
gb|BI309404.1|BI309404 EST530814 GPOD Medicago truncatula c... 52 1e-004
gb|BQ123287.1|BQ123287 EST608863 GLSD Medicago truncatula c... 52 1e-004
gb|BQ123655.1|BQ123655 EST609231 GLSD Medicago truncatula c... 52 1e-004
gb|BQ139624.1|BQ139624 NF022D03PH1F1029 Phoma-infected Medi... 52 1e-004
gb|BQ146393.1|BQ146393 NF069F03FL1F1031 Developing flower M... 52 1e-004
gb|AJ501241.1|AJ501241 AJ501241 MTAMP Medicago truncatula c... 52 1e-004
gb|CA916813.1|CA916813 EST640960 GPOD Medicago truncatula c... 52 1e-004
gb|CA916907.1|CA916907 EST641054 GPOD Medicago truncatula c... 52 1e-004
gb|CA917180.1|CA917180 EST641327 GPOD Medicago truncatula c... 52 1e-004
gb|CA917727.1|CA917727 EST641874 GPOD Medicago truncatula c... 52 1e-004
gb|CA918225.1|CA918225 EST642372 GPOD Medicago truncatula c... 52 1e-004
gb|CX517278.1|CX517278 s13dNF07A04VI033_399575 Virus-Infect... 52 1e-004
gb|CX518230.1|CX518230 s13dNF28E10VI071_422173 Virus-Infect... 52 1e-004
gb|CX520470.1|CX520470 s13dNF55B06VI046_448726 Virus-Infect... 52 1e-004
gb|CX520654.1|CX520654 s13dNF61D03VI026_449094 Virus-Infect... 52 1e-004
gb|CX521039.1|CX521039 s13dNF65A03VI017_449864 Virus-Infect... 52 1e-004
gb|CX521324.1|CX521324 s13dNF81E12VI099_450434 Virus-Infect... 52 1e-004
gb|CX521914.1|CX521914 s13dNF1FG10VI082_469632 Virus-Infect... 52 1e-004
gb|CX522458.1|CX522458 s13dNF86B03VI025_470720 Virus-Infect... 52 1e-004
gb|CX523135.1|CX523135 s13dNF80B04VI041_472074 Virus-Infect... 52 1e-004
gb|CX524048.1|CX524048 s13dNF03A07AT051_447440 Aphid-Infect... 52 1e-004
gb|CX527059.1|CX527059 s13dNF39E09AT071_514630 Aphid-Infect... 52 1e-004
gb|CX528006.1|CX528006 s13dNF50G01AT008_516524 Aphid-Infect... 52 1e-004
gb|DW015467.1|DW015467 EST1224428 MTY Medicago truncatula c... 52 1e-004
gb|AC136449.21| Medicago truncatula clone mth2-11k13, compl... 52 1e-004
gb|AC148528.15| Medicago truncatula clone mth2-53h4, comple... 52 1e-004
gb|BE239702.1|BE239702 EST403751 MHRP- Medicago truncatula ... 46 0.006
gb|AL365659.1|AL365659 MtBA01F12R1 MtBA Medicago truncatula... 46 0.006
gb|AL367728.1|AL367728 MtBA16H07R2 MtBA Medicago truncatula... 46 0.006
gb|AL367778.1|AL367778 MtBA19C04R1 MtBA Medicago truncatula... 46 0.006
gb|AL368190.1|AL368190 MtBA22G04R1 MtBA Medicago truncatula... 46 0.006
gb|AL372665.1|AL372665 MtBA52F06R1 MtBA Medicago truncatula... 46 0.006
gb|AL374621.1|AL374621 MtBB07F07R1 MtBB Medicago truncatula... 46 0.006
gb|AL384285.1|AL384285 MtBC21B09F1 MtBC Medicago truncatula... 46 0.006
gb|BQ750517.1|BQ750517 EST633253 KVKC Medicago truncatula c... 46 0.006
gb|CA921232.1|CA921232 EST638950 MTUS Medicago truncatula c... 46 0.006
gb|CA922844.1|CA922844 EST640562 MTUS Medicago truncatula c... 46 0.006
gb|CA919154.1|CA919154 EST636872 MTUS Medicago truncatula c... 46 0.006
gb|CA920796.1|CA920796 EST638514 MTUS Medicago truncatula c... 46 0.006
gb|AJ846022.1|AJ846022 AJ846022 MtSC4 Medicago truncatula c... 46 0.006
gb|CX523343.1|CX523343 s13dNF1TD06VI058_472490 Virus-Infect... 46 0.006
gb|DW019365.1|DW019365 EST1228326 MTY Medicago truncatula c... 46 0.006
gb|BF004587.1|BF004587 EST433085 KV1 Medicago truncatula cD... 44 0.025
gb|BF006710.1|BF006710 EST435208 DSLC Medicago truncatula c... 44 0.025
gb|BQ123267.1|BQ123267 EST608843 GLSD Medicago truncatula c... 44 0.025
gb|DW016460.1|DW016460 EST1225421 MTY Medicago truncatula c... 44 0.025
gb|BQ123354.1|BQ123354 EST608930 GLSD Medicago truncatula c... 42 0.099
gb|AC148292.8| Medicago truncatula clone mth2-15m24, comple... 42 0.099
gb|AC149807.10| Medicago truncatula clone mth2-151h1, WORKI... 42 0.099
gb|AC157647.19| Medicago truncatula clone mth2-66k5, WORKIN... 42 0.099
>gb|AA660318.1|AA660318 00189 MtRHE Medicago truncatula cDNA 5' similar to caffeoyl-CoA
3-O-methyltransferase, mRNA sequence
Length = 591
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 332 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 283
>gb|AI974778.1|AI974778 T113251e KV2 Medicago truncatula cDNA clone pKV2-1L7, mRNA sequence
Length = 508
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 279 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 230
>gb|AW256836.1|AW256836 EST304973 KV2 Medicago truncatula cDNA clone KV2-6A19, mRNA
sequence
Length = 541
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 317 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 268
>gb|AW257069.1|AW257069 EST305206 KV2 Medicago truncatula cDNA clone KV2-6J14, mRNA
sequence
Length = 505
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 317 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 268
>gb|AW559274.1|AW559274 EST306110 DSIR Medicago truncatula cDNA clone pDSIR-7P8, mRNA
sequence
Length = 444
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 197 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 148
>gb|AW684885.1|AW684885 NF022F07NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF022F07NR 5', mRNA sequence
Length = 640
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 342 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 293
>gb|AW690185.1|AW690185 NF029D09ST1F1000 Developing stem Medicago truncatula cDNA clone
NF029D09ST 5', mRNA sequence
Length = 685
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 347 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 298
>gb|AW695080.1|AW695080 NF091D11ST1F1093 Developing stem Medicago truncatula cDNA clone
NF091D11ST 5', mRNA sequence
Length = 643
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 341 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 292
>gb|AW775400.1|AW775400 EST334465 DSIL Medicago truncatula cDNA clone pDSIL-1N5, mRNA
sequence
Length = 728
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 317 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 268
>gb|AW776435.1|AW776435 EST335500 DSIL Medicago truncatula cDNA clone pDSIL-7L14, mRNA
sequence
Length = 605
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 356 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 307
>gb|BE202817.1|BE202817 EST402839 KV1 Medicago truncatula cDNA clone pKV1-3K6, mRNA
sequence
Length = 551
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 321 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 272
>gb|BE203346.1|BE203346 EST403368 KV1 Medicago truncatula cDNA clone pKV1-5A12, mRNA
sequence
Length = 639
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 317 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 268
>gb|BE203574.1|BE203574 EST396250 KV0 Medicago truncatula cDNA clone pKV0-10H23, mRNA
sequence
Length = 519
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 289 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 240
>gb|BE205077.1|BE205077 EST397753 KV0 Medicago truncatula cDNA clone pKV0-20C20, mRNA
sequence
Length = 606
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 308 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 259
>gb|AL368320.1|AL368320 MtBA23G02F1 MtBA Medicago truncatula cDNA clone MtBA23G02 T3, mRNA
sequence
Length = 390
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 330 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 281
>gb|AL372979.1|AL372979 MtBA54H07F1 MtBA Medicago truncatula cDNA clone MtBA54H07 T3, mRNA
sequence
Length = 426
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 341 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 292
>gb|AL373431.1|AL373431 MtBA57G08F1 MtBA Medicago truncatula cDNA clone MtBA57G08 T3, mRNA
sequence
Length = 459
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 341 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 292
>gb|AL379484.1|AL379484 MtBB45F04F1 MtBB Medicago truncatula cDNA clone MtBB45F04 T3, mRNA
sequence
Length = 431
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 340 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 291
>gb|AL380137.1|AL380137 MtBB50F08F1 MtBB Medicago truncatula cDNA clone MtBB50F08 T3, mRNA
sequence
Length = 481
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 342 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 293
>gb|BE998217.1|BE998217 EST429940 GVSN Medicago truncatula cDNA clone pGVSN-9O7, mRNA
sequence
Length = 510
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 319 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 270
>gb|BE998654.1|BE998654 EST430377 GVSN Medicago truncatula cDNA clone pGVSN-12N15, mRNA
sequence
Length = 564
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 317 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 268
>gb|BF005451.1|BF005451 EST433949 DSLC Medicago truncatula cDNA clone pDSLC-37B11, mRNA
sequence
Length = 505
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 317 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 268
>gb|BF519321.1|BF519321 EST456783 DSIL Medicago truncatula cDNA clone pDSIL-20I16, mRNA
sequence
Length = 519
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 331 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 282
>gb|BF519907.1|BF519907 EST457372 DSIL Medicago truncatula cDNA clone pDSIL-22E9, mRNA
sequence
Length = 457
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 230 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 181
>gb|BF520898.1|BF520898 EST458371 DSIL Medicago truncatula cDNA clone pDSIL-39D12, mRNA
sequence
Length = 637
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 216 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 167
>gb|BF634788.1|BF634788 NF069G09DT1F1071 Drought Medicago truncatula cDNA clone NF069G09DT
5', mRNA sequence
Length = 697
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 324 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 275
>gb|BF635750.1|BF635750 NF040F09DT1F1076 Drought Medicago truncatula cDNA clone NF040F09DT
5', mRNA sequence
Length = 499
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 346 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 297
>gb|BF636068.1|BF636068 NF069E08DT1F1066 Drought Medicago truncatula cDNA clone NF069E08DT
5', mRNA sequence
Length = 667
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 279 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 230
>gb|BF636493.1|BF636493 NF088G06DT1F1051 Drought Medicago truncatula cDNA clone NF088G06DT
5', mRNA sequence
Length = 519
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 189 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 140
>gb|BF642362.1|BF642362 NF051D11IN1F1093 Insect herbivory Medicago truncatula cDNA clone
NF051D11IN 5', mRNA sequence
Length = 676
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 349 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 300
>gb|BF649045.1|BF649045 NF052B03EC1F1027 Elicited cell culture Medicago truncatula cDNA
clone NF052B03EC 5', mRNA sequence
Length = 514
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 344 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 295
>gb|AW695176.2|AW695176 NF092D12ST1F1101 Developing stem Medicago truncatula cDNA clone
NF092D12ST 5', mRNA sequence
Length = 578
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 253 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 204
>gb|BE316596.2|BE316596 NF057C11LF1F1082 Developing leaf Medicago truncatula cDNA clone
NF057C11LF 5', mRNA sequence
Length = 551
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 344 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 295
>gb|BE322493.2|BE322493 NF008D09IN1F1075 Insect herbivory Medicago truncatula cDNA clone
NF008D09IN 5', mRNA sequence
Length = 456
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 344 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 295
>gb|BE248039.2|BE248039 NF002H01DT1F1012 Drought Medicago truncatula cDNA clone NF002H01DT
5', mRNA sequence
Length = 425
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 344 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 295
>gb|BG448465.1|BG448465 NF036C01RT1F1002 Developing root Medicago truncatula cDNA clone
NF036C01RT 5', mRNA sequence
Length = 572
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 345 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 296
>gb|BG450822.1|BG450822 NF093D04DT1F1032 Drought Medicago truncatula cDNA clone NF093D04DT
5', mRNA sequence
Length = 685
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 189 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 140
>gb|BG453059.1|BG453059 NF089H11LF1F1093 Developing leaf Medicago truncatula cDNA clone
NF089H11LF 5', mRNA sequence
Length = 618
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 344 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 295
>gb|BG453560.1|BG453560 NF096D07LF1F1059 Developing leaf Medicago truncatula cDNA clone
NF096D07LF 5', mRNA sequence
Length = 638
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 340 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 291
>gb|BG453602.1|BG453602 NF098F01LF1F1011 Developing leaf Medicago truncatula cDNA clone
NF098F01LF 5', mRNA sequence
Length = 666
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 344 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 295
>gb|BG646445.1|BG646445 EST508064 HOGA Medicago truncatula cDNA clone pHOGA-7H12 5' end,
mRNA sequence
Length = 694
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 304 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 255
>gb|BI270143.1|BI270143 NF052B07FL1F1061 Developing flower Medicago truncatula cDNA clone
NF052B07FL 5', mRNA sequence
Length = 655
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 344 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 295
>gb|BI308179.1|BI308179 EST529589 GPOD Medicago truncatula cDNA clone pGPOD-2I10 5' end,
mRNA sequence
Length = 563
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 126 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 77
>gb|BI308339.1|BI308339 EST529749 GPOD Medicago truncatula cDNA clone pGPOD-2F18 5' end,
mRNA sequence
Length = 703
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 317 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 268
>gb|BI308775.1|BI308775 EST530185 GPOD Medicago truncatula cDNA clone pGPOD-8P3 5' end,
mRNA sequence
Length = 789
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 318 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 269
>gb|BI309404.1|BI309404 EST530814 GPOD Medicago truncatula cDNA clone pGPOD-11J7 5' end,
mRNA sequence
Length = 613
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 339 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 290
>gb|BQ123287.1|BQ123287 EST608863 GLSD Medicago truncatula cDNA clone pGLSD-31N9, mRNA
sequence
Length = 715
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 149 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 100
>gb|BQ123655.1|BQ123655 EST609231 GLSD Medicago truncatula cDNA clone pGLSD-32P18, mRNA
sequence
Length = 599
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 399 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 350
>gb|BQ139624.1|BQ139624 NF022D03PH1F1029 Phoma-infected Medicago truncatula cDNA clone
NF022D03PH 5', mRNA sequence
Length = 474
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 347 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 298
>gb|BQ146393.1|BQ146393 NF069F03FL1F1031 Developing flower Medicago truncatula cDNA clone
NF069F03FL 5', mRNA sequence
Length = 683
Score = 52.0 bits (26), Expect = 1e-004
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 343 gtggcaaggagggagtagccagtgtagacaccaatttccatggtgttctt 294
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 125,895
Number of Sequences: 392609
Number of extensions: 125895
Number of successful extensions: 10016
Number of sequences better than 0.5: 95
Number of HSP's better than 0.5 without gapping: 95
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9763
Number of HSP's gapped (non-prelim): 253
length of query: 1115
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1095
effective length of database: 433,880,813
effective search space: 475099490235
effective search space used: 475099490235
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)