BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2448753.2.1
         (537 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BE319206.2|BE319206  NF045C01LF1F1003 Developing leaf Med...    48   8e-004
gb|BG452954.1|BG452954  NF088G11LF1F1085 Developing leaf Med...    48   8e-004
emb|CR294482.1|  mte1-10I10RM1 BAC end, cultivar Jemalong A1...    40   0.19 
gb|AW775786.1|AW775786  EST334851 DSIL Medicago truncatula c...    40   0.19 
gb|AL374421.1|AL374421  MtBB06E05F1 MtBB Medicago truncatula...    40   0.19 
gb|AJ847011.1|AJ847011  AJ847011 MtSTW Medicago truncatula c...    40   0.19 
gb|AJ847287.1|AJ847287  AJ847287 MtSTW Medicago truncatula c...    40   0.19 
gb|AC140915.6|  Medicago truncatula clone mth2-10l24, comple...    40   0.19 

>gb|BE319206.2|BE319206 NF045C01LF1F1003 Developing leaf Medicago truncatula cDNA clone
           NF045C01LF 5', mRNA sequence
          Length = 575

 Score = 48.1 bits (24), Expect = 8e-004
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 212 tatggacaagttattgaagctaagattatccttgatcgtgagtctgggaggtccagaggt 271
           |||||| | ||| |||| || ||||||||| | ||||||||  | || |||||| |||||
Sbjct: 209 tatggagatgttcttgatgcaaagattatcatggatcgtgatacaggaaggtcccgaggt 268

                           
Query: 272 tttggctttataactt 287
           |||||||| |||||||
Sbjct: 269 tttggcttcataactt 284



>gb|BG452954.1|BG452954 NF088G11LF1F1085 Developing leaf Medicago truncatula cDNA clone
           NF088G11LF 5', mRNA sequence
          Length = 343

 Score = 48.1 bits (24), Expect = 8e-004
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 212 tatggacaagttattgaagctaagattatccttgatcgtgagtctgggaggtccagaggt 271
           |||||| | ||| |||| || ||||||||| | ||||||||  | || |||||| |||||
Sbjct: 102 tatggagatgttcttgatgcaaagattatcatggatcgtgatacaggaaggtcccgaggt 161

                           
Query: 272 tttggctttataactt 287
           |||||||| |||||||
Sbjct: 162 tttggcttcataactt 177



>emb|CR294482.1| mte1-10I10RM1 BAC end, cultivar Jemalong A17 of Medicago
           truncatula, genomic survey sequence
          Length = 623

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 513 gtgactatggtggcggcagtggtg 536
           |||||||||||||||| |||||||
Sbjct: 227 gtgactatggtggcgggagtggtg 204



>gb|AW775786.1|AW775786 EST334851 DSIL Medicago truncatula cDNA clone pDSIL-3K7, mRNA
           sequence
          Length = 606

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 233 aagattatccttgatcgtgagtctgggaggtccagaggttttgg 276
           |||||||||  |||||||||  |||| || ||||||||||||||
Sbjct: 118 aagattatcaatgatcgtgaaactggaagatccagaggttttgg 161



>gb|AL374421.1|AL374421 MtBB06E05F1 MtBB Medicago truncatula cDNA clone MtBB06E05 T3, mRNA
           sequence
          Length = 310

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 233 aagattatccttgatcgtgagtctgggaggtccagaggttttgg 276
           |||||||||  |||||||||  |||| || ||||||||||||||
Sbjct: 104 aagattatcaatgatcgtgaaactggaagatccagaggttttgg 147



>gb|AJ847011.1|AJ847011 AJ847011 MtSTW Medicago truncatula cDNA clone MtTW03F21N1, mRNA
           sequence
          Length = 326

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 233 aagattatccttgatcgtgagtctgggaggtccagaggttttgg 276
           |||||||||  |||||||||  |||| || ||||||||||||||
Sbjct: 113 aagattatcaatgatcgtgaaactggaagatccagaggttttgg 156



>gb|AJ847287.1|AJ847287 AJ847287 MtSTW Medicago truncatula cDNA clone MtTW07M24N2, mRNA
           sequence
          Length = 437

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 233 aagattatccttgatcgtgagtctgggaggtccagaggttttgg 276
           |||||||||  |||||||||  |||| || ||||||||||||||
Sbjct: 139 aagattatcaatgatcgtgaaactggaagatccagaggttttgg 182



>gb|AC140915.6| Medicago truncatula clone mth2-10l24, complete sequence
          Length = 120364

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 513   gtgactatggtggcggcagtggtg 536
             |||||||||||||||| |||||||
Sbjct: 27683 gtgactatggtggcgggagtggtg 27706



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 88,297
Number of Sequences: 392609
Number of extensions: 88297
Number of successful extensions: 6199
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6185
Number of HSP's gapped (non-prelim): 14
length of query: 537
length of database: 441,732,993
effective HSP length: 19
effective length of query: 518
effective length of database: 434,273,422
effective search space: 224953632596
effective search space used: 224953632596
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)