BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2419405.2.3
         (1600 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG924305.1|CG924305  MBEGO84TR mth2 Medicago truncatula g...    44   0.036
gb|BG457173.1|BG457173  NF100F02PL1F1025 Phosphate starved l...    44   0.036
gb|DW016987.1|DW016987  EST1225948 MTY Medicago truncatula c...    44   0.036
gb|AC147715.10|  Medicago truncatula clone mth2-76b9, WORKIN...    44   0.036
gb|AJ389008.1|AJ389008  AJ389008 Medicago truncatula R108 Me...    42   0.14 
gb|CF069940.1|CF069940  EST670661 MTUS Medicago truncatula c...    42   0.14 
gb|CX520741.1|CX520741  s13dNF62E01VI003_449268 Virus-Infect...    42   0.14 
gb|AC157503.3|  Medicago truncatula chromosome 2 BAC clone m...    42   0.14 
>gb|CG924305.1|CG924305 MBEGO84TR mth2 Medicago truncatula genomic clone 51N23, DNA
           sequence
          Length = 846

 Score = 44.1 bits (22), Expect = 0.036
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 202 tgaagatgatgatgatgataaa 223
           ||||||||||||||||||||||
Sbjct: 373 tgaagatgatgatgatgataaa 352
>gb|BG457173.1|BG457173 NF100F02PL1F1025 Phosphate starved leaf Medicago truncatula cDNA
           clone NF100F02PL 5', mRNA sequence
          Length = 660

 Score = 44.1 bits (22), Expect = 0.036
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 199 gaatgaagatgatgatgatgat 220
           ||||||||||||||||||||||
Sbjct: 50  gaatgaagatgatgatgatgat 29
>gb|DW016987.1|DW016987 EST1225948 MTY Medicago truncatula cDNA clone MTYAO09, mRNA
           sequence
          Length = 689

 Score = 44.1 bits (22), Expect = 0.036
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 199 gaatgaagatgatgatgatgat 220
           ||||||||||||||||||||||
Sbjct: 148 gaatgaagatgatgatgatgat 127
>gb|AC147715.10| Medicago truncatula clone mth2-76b9, WORKING DRAFT SEQUENCE, 24
             unordered pieces
          Length = 81122

 Score = 44.1 bits (22), Expect = 0.036
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 202   tgaagatgatgatgatgataaa 223
             ||||||||||||||||||||||
Sbjct: 52953 tgaagatgatgatgatgataaa 52932
>gb|AJ389008.1|AJ389008 AJ389008 Medicago truncatula R108 Medicago truncatula cDNA clone
           MtNo385, mRNA sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 203 gaagatgatgatgatgataaa 223
           |||||||||||||||||||||
Sbjct: 149 gaagatgatgatgatgataaa 169
>gb|CF069940.1|CF069940 EST670661 MTUS Medicago truncatula cDNA clone MTUS-26B2, mRNA
           sequence
          Length = 575

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 200 aatgaagatgatgatgatgat 220
           |||||||||||||||||||||
Sbjct: 97  aatgaagatgatgatgatgat 117
>gb|CX520741.1|CX520741 s13dNF62E01VI003_449268 Virus-Infected Leaves Medicago truncatula
           cDNA, mRNA sequence
          Length = 452

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 200 aatgaagatgatgatgatgat 220
           |||||||||||||||||||||
Sbjct: 421 aatgaagatgatgatgatgat 441
>gb|AC157503.3| Medicago truncatula chromosome 2 BAC clone mte1-58k20, complete
             sequence
          Length = 115769

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 200   aatgaagatgatgatgatgat 220
             |||||||||||||||||||||
Sbjct: 84793 aatgaagatgatgatgatgat 84773
  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 232,892
Number of Sequences: 392609
Number of extensions: 232892
Number of successful extensions: 27896
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27870
Number of HSP's gapped (non-prelim): 23
length of query: 1600
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1580
effective length of database: 433,880,813
effective search space: 685531684540
effective search space used: 685531684540
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)