BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2419137.2.1
         (989 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AL375359.1|AL375359  MtBB14A10R1 MtBB Medicago truncatula...    44   0.022
gb|AC151825.26|  Medicago truncatula clone mth2-48b19, WORKI...    40   0.35 
gb|AC157985.12|  Medicago truncatula clone mth2-150l20, WORK...    40   0.35 
gb|AC151825.27|  Medicago truncatula clone mth2-48b19, WORKI...    40   0.35 
gb|AC157985.13|  Medicago truncatula clone mth2-150l20, WORK...    40   0.35 

>gb|AL375359.1|AL375359 MtBB14A10R1 MtBB Medicago truncatula cDNA clone MtBB14A10 T7, mRNA
           sequence
          Length = 400

 Score = 44.1 bits (22), Expect = 0.022
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 37  tggtggtggtggaagcggtggcggcggcgg 66
           ||||||||||||| |||||||||| |||||
Sbjct: 99  tggtggtggtggaggcggtggcggtggcgg 128



>gb|AC151825.26| Medicago truncatula clone mth2-48b19, WORKING DRAFT SEQUENCE, 4
             unordered pieces
          Length = 138177

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   atatatatgatgtagtatta 434
             ||||||||||||||||||||
Sbjct: 56155 atatatatgatgtagtatta 56136



>gb|AC157985.12| Medicago truncatula clone mth2-150l20, WORKING DRAFT SEQUENCE, 6
             ordered pieces
          Length = 120638

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   atatatatgatgtagtatta 434
             ||||||||||||||||||||
Sbjct: 85088 atatatatgatgtagtatta 85069



>gb|AC151825.27| Medicago truncatula clone mth2-48b19, WORKING DRAFT SEQUENCE, 4
             unordered pieces
          Length = 138175

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   atatatatgatgtagtatta 434
             ||||||||||||||||||||
Sbjct: 56153 atatatatgatgtagtatta 56134



>gb|AC157985.13| Medicago truncatula clone mth2-150l20, WORKING DRAFT SEQUENCE, 2
             ordered pieces
          Length = 119647

 Score = 40.1 bits (20), Expect = 0.35
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 415   atatatatgatgtagtatta 434
             ||||||||||||||||||||
Sbjct: 42384 atatatatgatgtagtatta 42403



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 172,112
Number of Sequences: 392609
Number of extensions: 172112
Number of successful extensions: 13541
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13531
Number of HSP's gapped (non-prelim): 10
length of query: 989
length of database: 441,732,993
effective HSP length: 20
effective length of query: 969
effective length of database: 433,880,813
effective search space: 420430507797
effective search space used: 420430507797
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)