BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2405087.2.1
         (737 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|CR492785.1|  mth2-166H18FM1 BAC end, cultivar Jemalong A...    48   0.001
gb|AC152887.20|  Medicago truncatula clone mth2-91j4, WORKIN...    48   0.001
gb|AC157648.18|  Medicago truncatula clone mth2-68d9, comple...    48   0.001
gb|CB893717.1|CB893717  EST646509 HOGA Medicago truncatula c...    44   0.016
gb|AL377568.1|AL377568  MtBB32D12R1 MtBB Medicago truncatula...    42   0.065
gb|AC121232.52|  Medicago truncatula clone mth2-11a18, WORKI...    42   0.065
gb|CG961642.1|CG961642  MBECV54TR mth2 Medicago truncatula g...    40   0.26 
emb|CR497530.1|  mth2-173F21FM1 BAC end, cultivar Jemalong A...    40   0.26 
gb|AC146723.24|  Medicago truncatula clone mth2-34n4, WORKIN...    40   0.26 

>emb|CR492785.1| mth2-166H18FM1 BAC end, cultivar Jemalong A17 of Medicago
           truncatula, genomic survey sequence
          Length = 742

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 328 tgattttgatgctttcatctgcaatagtgggagtaacatttactatcc 375
           ||||||||||||||| || |||| |||||||||| |  ||||||||||
Sbjct: 707 tgattttgatgctttgatttgcagtagtgggagtgaactttactatcc 660



>gb|AC152887.20| Medicago truncatula clone mth2-91j4, WORKING DRAFT SEQUENCE, 2 ordered
              pieces
          Length = 116277

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 328    tgattttgatgctttcatctgcaatagtgggagtaacatttactatcc 375
              ||||||||||||||| || |||| |||||||||| |  ||||||||||
Sbjct: 112566 tgattttgatgctttgatttgcagtagtgggagtgaactttactatcc 112519



>gb|AC157648.18| Medicago truncatula clone mth2-68d9, complete sequence
          Length = 84361

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 328   tgattttgatgctttcatctgcaatagtgggagtaacatttactatcc 375
             ||||||||||||||| || |||| |||||||||| |  ||||||||||
Sbjct: 61268 tgattttgatgctttgatttgcagtagtgggagtgaactttactatcc 61315



>gb|CB893717.1|CB893717 EST646509 HOGA Medicago truncatula cDNA clone HOGA-28F4, mRNA
           sequence
          Length = 843

 Score = 44.1 bits (22), Expect = 0.016
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 328 tgattttgatgctttcatctgcaatagtgggagt 361
           ||||||||||||||| || |||| ||||||||||
Sbjct: 804 tgattttgatgctttgatttgcagtagtgggagt 837



>gb|AL377568.1|AL377568 MtBB32D12R1 MtBB Medicago truncatula cDNA clone MtBB32D12 T7, mRNA
           sequence
          Length = 477

 Score = 42.1 bits (21), Expect = 0.065
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 199 gataatcagaaatgctattga 219
           |||||||||||||||||||||
Sbjct: 435 gataatcagaaatgctattga 415



>gb|AC121232.52| Medicago truncatula clone mth2-11a18, WORKING DRAFT SEQUENCE, 2 ordered
             pieces
          Length = 106247

 Score = 42.1 bits (21), Expect = 0.065
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 199   gataatcagaaatgctattga 219
             |||||||||||||||||||||
Sbjct: 22733 gataatcagaaatgctattga 22753



>gb|CG961642.1|CG961642 MBECV54TR mth2 Medicago truncatula genomic clone 29I12, DNA
           sequence
          Length = 833

 Score = 40.1 bits (20), Expect = 0.26
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 145 gaagaatatcattgttatttctgt 168
           |||||||||||| |||||||||||
Sbjct: 308 gaagaatatcatagttatttctgt 285



>emb|CR497530.1| mth2-173F21FM1 BAC end, cultivar Jemalong A17 of Medicago
           truncatula, genomic survey sequence
          Length = 385

 Score = 40.1 bits (20), Expect = 0.26
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 145 gaagaatatcattgttatttctgt 168
           |||||||||||| |||||||||||
Sbjct: 348 gaagaatatcatagttatttctgt 325



>gb|AC146723.24| Medicago truncatula clone mth2-34n4, WORKING DRAFT SEQUENCE, 3 ordered
             pieces
          Length = 121085

 Score = 40.1 bits (20), Expect = 0.26
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 145   gaagaatatcattgttatttctgt 168
             |||||||||||| |||||||||||
Sbjct: 79080 gaagaatatcatagttatttctgt 79103



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 241,525
Number of Sequences: 392609
Number of extensions: 241525
Number of successful extensions: 19820
Number of sequences better than  0.5: 9
Number of HSP's better than  0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19793
Number of HSP's gapped (non-prelim): 27
length of query: 737
length of database: 441,732,993
effective HSP length: 19
effective length of query: 718
effective length of database: 434,273,422
effective search space: 311808316996
effective search space used: 311808316996
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)