BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2276425.2.1
(753 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CG962262.1|CG962262 MBEEP40TRB mth2 Medicago truncatula ... 88 1e-015
gb|BE202442.1|BE202442 EST392891 KV1 Medicago truncatula cD... 50 3e-004
gb|BE202431.1|BE202431 EST392880 KV1 Medicago truncatula cD... 50 3e-004
gb|AL368953.1|AL368953 MtBA27H12R1 MtBA Medicago truncatula... 50 3e-004
gb|BG647806.1|BG647806 EST509425 HOGA Medicago truncatula c... 50 3e-004
gb|CA920561.1|CA920561 EST638279 MTUS Medicago truncatula c... 50 3e-004
gb|AC159534.11| Medicago truncatula clone mth2-81a23, compl... 44 0.017
gb|AC149213.20| Medicago truncatula clone mth2-105p11, WORK... 44 0.017
gb|CG960796.1|CG960796 MBEIF81TF mth2 Medicago truncatula g... 42 0.067
gb|CG973096.1|CG973096 MBEBJ39TF mth2 Medicago truncatula g... 42 0.067
emb|CR501865.1| mth2-144F2RM1 BAC end, cultivar Jemalong A1... 42 0.067
emb|CR968494.1| mth4-27N10FM1 BAC end, cultivar Jemalong A1... 42 0.067
gb|AC146587.20| Medicago truncatula clone mth2-144j8, compl... 42 0.067
gb|CG939621.1|CG939621 MBEIS83TF mth2 Medicago truncatula g... 40 0.26
>gb|CG962262.1|CG962262 MBEEP40TRB mth2 Medicago truncatula genomic clone 39H8, DNA
sequence
Length = 911
Score = 87.7 bits (44), Expect = 1e-015
Identities = 209/264 (79%)
Strand = Plus / Plus
Query: 32 tggggtgataaggcttaccttgagaatgggtactacctccacggctactgggggatcttg 91
||||||||||||| ||| ||||||||||| || ||| | || || || |||||||| |||
Sbjct: 358 tggggtgataaggtttatcttgagaatggttattacttgcatggttattgggggattttg 417
Query: 92 gtcgacaggtacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtgg 151
|| || || || ||||||||| |||||||||| | || || | || ||||| |||||
Sbjct: 418 gttgatagatatgaggagatgattgagaattatcatcctggttttggtgatcataggtgg 477
Query: 152 ccactcgtcacacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgtc 211
||| | || || || ||||| ||||| ||||| ||||| || || || || || |||||
Sbjct: 478 ccattggtgactcattttgtggggtgtaagccttgtgggaagttcggtgattatcctgtg 537
Query: 212 gagcgatgcctcaagaatatggaccgtgcattcaattttggggataaccagatcttgcag 271
||| ||||| | ||| | ||||| | || ||||||||||| ||||| ||||| ||||||
Sbjct: 538 gagagatgcttgaagcagatggatagagctttcaattttggtgataatcagatattgcag 597
Query: 272 atgtatgggttcacacacaagtca 295
|| ||||| ||||| |||||||||
Sbjct: 598 atttatggattcactcacaagtca 621
>gb|BE202442.1|BE202442 EST392891 KV1 Medicago truncatula cDNA clone pKV1-2K23, mRNA
sequence
Length = 551
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 245 aattttggggataaccagatcttgcagatgtatgggttcacacacaagtcact 297
|||||||| ||||| ||||| |||||||||||||| || || || ||||||||
Sbjct: 133 aattttggtgataatcagatattgcagatgtatggttttactcataagtcact 185
>gb|BE202431.1|BE202431 EST392880 KV1 Medicago truncatula cDNA clone pKV1-2K11, mRNA
sequence
Length = 573
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 245 aattttggggataaccagatcttgcagatgtatgggttcacacacaagtcact 297
|||||||| ||||| ||||| |||||||||||||| || || || ||||||||
Sbjct: 155 aattttggtgataatcagatattgcagatgtatggttttactcataagtcact 207
>gb|AL368953.1|AL368953 MtBA27H12R1 MtBA Medicago truncatula cDNA clone MtBA27H12 T7, mRNA
sequence
Length = 519
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 245 aattttggggataaccagatcttgcagatgtatgggttcacacacaagtcact 297
|||||||| ||||| ||||| |||||||||||||| || || || ||||||||
Sbjct: 144 aattttggtgataatcagatattgcagatgtatggttttactcataagtcact 196
>gb|BG647806.1|BG647806 EST509425 HOGA Medicago truncatula cDNA clone pHOGA-17P10 5' end,
mRNA sequence
Length = 470
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 245 aattttggggataaccagatcttgcagatgtatgggttcacacacaagtcact 297
|||||||| ||||| ||||| |||||||||||||| || || || ||||||||
Sbjct: 392 aattttggtgataatcagatattgcagatgtatggttttactcataagtcact 444
>gb|CA920561.1|CA920561 EST638279 MTUS Medicago truncatula cDNA clone MTUS-29G1, mRNA
sequence
Length = 647
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 245 aattttggggataaccagatcttgcagatgtatgggttcacacacaagtcact 297
|||||||| ||||| ||||| |||||||||||||| || || || ||||||||
Sbjct: 424 aattttggtgataatcagatattgcagatgtatggttttactcataagtcact 372
>gb|AC159534.11| Medicago truncatula clone mth2-81a23, complete sequence
Length = 120504
Score = 44.1 bits (22), Expect = 0.017
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 420 acaattcaacttgttattttct 441
||||||||||||||||||||||
Sbjct: 61080 acaattcaacttgttattttct 61059
>gb|AC149213.20| Medicago truncatula clone mth2-105p11, WORKING DRAFT SEQUENCE
Length = 117767
Score = 44.1 bits (22), Expect = 0.017
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 420 acaattcaacttgttattttct 441
||||||||||||||||||||||
Sbjct: 16087 acaattcaacttgttattttct 16066
>gb|CG960796.1|CG960796 MBEIF81TF mth2 Medicago truncatula genomic clone 61M18, DNA
sequence
Length = 808
Score = 42.1 bits (21), Expect = 0.067
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 577 gtttatttattggcataagttatgt 601
|||||| ||||||||||||||||||
Sbjct: 180 gtttatctattggcataagttatgt 156
>gb|CG973096.1|CG973096 MBEBJ39TF mth2 Medicago truncatula genomic clone 19G6, DNA sequence
Length = 756
Score = 42.1 bits (21), Expect = 0.067
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 577 gtttatttattggcataagttatgt 601
|||||| ||||||||||||||||||
Sbjct: 140 gtttatctattggcataagttatgt 116
>emb|CR501865.1| mth2-144F2RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 681
Score = 42.1 bits (21), Expect = 0.067
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 577 gtttatttattggcataagttatgt 601
|||||| ||||||||||||||||||
Sbjct: 180 gtttatctattggcataagttatgt 156
>emb|CR968494.1| mth4-27N10FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 763
Score = 42.1 bits (21), Expect = 0.067
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 577 gtttatttattggcataagttatgt 601
|||||| ||||||||||||||||||
Sbjct: 180 gtttatctattggcataagttatgt 156
>gb|AC146587.20| Medicago truncatula clone mth2-144j8, complete sequence
Length = 113373
Score = 42.1 bits (21), Expect = 0.067
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 577 gtttatttattggcataagttatgt 601
|||||| ||||||||||||||||||
Sbjct: 74573 gtttatctattggcataagttatgt 74597
>gb|CG939621.1|CG939621 MBEIS83TF mth2 Medicago truncatula genomic clone 64N21, DNA
sequence
Length = 882
Score = 40.1 bits (20), Expect = 0.26
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 242 ttcaattttggggataaccagatcttgcagatgtatgggttcac 285
||||||||||| ||||| || || |||||||| ||||| |||||
Sbjct: 337 ttcaattttggtgataatcatatattgcagatttatggattcac 294
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 199,886
Number of Sequences: 392609
Number of extensions: 199886
Number of successful extensions: 14357
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14323
Number of HSP's gapped (non-prelim): 34
length of query: 753
length of database: 441,732,993
effective HSP length: 19
effective length of query: 734
effective length of database: 434,273,422
effective search space: 318756691748
effective search space used: 318756691748
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)