BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2192890.2.1
(531 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE321531.2|BE321531 NF024C12IN1F1086 Insect herbivory Me... 40 0.18
gb|AC145372.6| Medicago truncatula clone mth2-5f4, complete... 40 0.18
gb|AC137521.31| Medicago truncatula clone mth2-11o9, WORKIN... 40 0.18
>gb|BE321531.2|BE321531 NF024C12IN1F1086 Insect herbivory Medicago truncatula cDNA clone
NF024C12IN 5', mRNA sequence
Length = 597
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 249 ttgtttacttggatcctatg 268
||||||||||||||||||||
Sbjct: 517 ttgtttacttggatcctatg 536
>gb|AC145372.6| Medicago truncatula clone mth2-5f4, complete sequence
Length = 94657
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 453 atttttgatttgatgggtta 472
||||||||||||||||||||
Sbjct: 1631 atttttgatttgatgggtta 1612
>gb|AC137521.31| Medicago truncatula clone mth2-11o9, WORKING DRAFT SEQUENCE, 16
unordered pieces
Length = 291529
Score = 40.1 bits (20), Expect = 0.18
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 453 atttttgatttgatgggtta 472
||||||||||||||||||||
Sbjct: 51962 atttttgatttgatgggtta 51981
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 147,037
Number of Sequences: 392609
Number of extensions: 147037
Number of successful extensions: 10990
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10971
Number of HSP's gapped (non-prelim): 19
length of query: 531
length of database: 441,732,993
effective HSP length: 19
effective length of query: 512
effective length of database: 434,273,422
effective search space: 222347992064
effective search space used: 222347992064
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)