BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2161272.2.19
         (1410 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC152964.9|  Medicago truncatula clone mth2-82o6, WORKING...    40   0.50 
gb|AC153353.19|  Medicago truncatula clone mth2-182o15, comp...    40   0.50 

>gb|AC152964.9| Medicago truncatula clone mth2-82o6, WORKING DRAFT SEQUENCE, 2 ordered
              pieces
          Length = 105277

 Score = 40.1 bits (20), Expect = 0.50
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    tgactgcatgatggagatca 266
              ||||||||||||||||||||
Sbjct: 102244 tgactgcatgatggagatca 102263



>gb|AC153353.19| Medicago truncatula clone mth2-182o15, complete sequence
          Length = 86812

 Score = 40.1 bits (20), Expect = 0.50
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   tgactgcatgatggagatca 266
             ||||||||||||||||||||
Sbjct: 59628 tgactgcatgatggagatca 59609



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 209,926
Number of Sequences: 392609
Number of extensions: 209926
Number of successful extensions: 15861
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15852
Number of HSP's gapped (non-prelim): 9
length of query: 1410
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1390
effective length of database: 433,880,813
effective search space: 603094330070
effective search space used: 603094330070
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)