BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 1366945.2.1
         (1191 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AA660995.1|AA660995  00892 MtRHE Medicago truncatula cDNA...    40   0.42 
gb|AL372160.1|AL372160  MtBA49A06F1 MtBA Medicago truncatula...    40   0.42 
gb|BQ139069.1|BQ139069  NF010G09PH1F1069 Phoma-infected Medi...    40   0.42 
gb|AC137508.11|  Medicago truncatula clone mth2-17m13, WORKI...    40   0.42 
>gb|AA660995.1|AA660995 00892 MtRHE Medicago truncatula cDNA 5', mRNA sequence
          Length = 694

 Score = 40.1 bits (20), Expect = 0.42
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 876 gctgctcctgctgcagctgcaact 899
           |||||| |||||||||||||||||
Sbjct: 357 gctgctgctgctgcagctgcaact 380
>gb|AL372160.1|AL372160 MtBA49A06F1 MtBA Medicago truncatula cDNA clone MtBA49A06 T3, mRNA
           sequence
          Length = 460

 Score = 40.1 bits (20), Expect = 0.42
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 876 gctgctcctgctgcagctgcaact 899
           |||||| |||||||||||||||||
Sbjct: 117 gctgctgctgctgcagctgcaact 140
>gb|BQ139069.1|BQ139069 NF010G09PH1F1069 Phoma-infected Medicago truncatula cDNA clone
           NF010G09PH 5', mRNA sequence
          Length = 671

 Score = 40.1 bits (20), Expect = 0.42
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 876 gctgctcctgctgcagctgcaact 899
           |||||| |||||||||||||||||
Sbjct: 367 gctgctgctgctgcagctgcaact 390
>gb|AC137508.11| Medicago truncatula clone mth2-17m13, WORKING DRAFT SEQUENCE, 24
             unordered pieces
          Length = 91797

 Score = 40.1 bits (20), Expect = 0.42
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1048  taatatacatatacatacta 1067
             ||||||||||||||||||||
Sbjct: 51246 taatatacatatacatacta 51227
  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 170,584
Number of Sequences: 392609
Number of extensions: 170584
Number of successful extensions: 12979
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12971
Number of HSP's gapped (non-prelim): 8
length of query: 1191
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1171
effective length of database: 433,880,813
effective search space: 508074432023
effective search space used: 508074432023
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)