BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1366945.2.1
(1191 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AA660995.1|AA660995 00892 MtRHE Medicago truncatula cDNA... 40 0.42
gb|AL372160.1|AL372160 MtBA49A06F1 MtBA Medicago truncatula... 40 0.42
gb|BQ139069.1|BQ139069 NF010G09PH1F1069 Phoma-infected Medi... 40 0.42
gb|AC137508.11| Medicago truncatula clone mth2-17m13, WORKI... 40 0.42
>gb|AA660995.1|AA660995 00892 MtRHE Medicago truncatula cDNA 5', mRNA sequence
Length = 694
Score = 40.1 bits (20), Expect = 0.42
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 876 gctgctcctgctgcagctgcaact 899
|||||| |||||||||||||||||
Sbjct: 357 gctgctgctgctgcagctgcaact 380
>gb|AL372160.1|AL372160 MtBA49A06F1 MtBA Medicago truncatula cDNA clone MtBA49A06 T3, mRNA
sequence
Length = 460
Score = 40.1 bits (20), Expect = 0.42
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 876 gctgctcctgctgcagctgcaact 899
|||||| |||||||||||||||||
Sbjct: 117 gctgctgctgctgcagctgcaact 140
>gb|BQ139069.1|BQ139069 NF010G09PH1F1069 Phoma-infected Medicago truncatula cDNA clone
NF010G09PH 5', mRNA sequence
Length = 671
Score = 40.1 bits (20), Expect = 0.42
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 876 gctgctcctgctgcagctgcaact 899
|||||| |||||||||||||||||
Sbjct: 367 gctgctgctgctgcagctgcaact 390
>gb|AC137508.11| Medicago truncatula clone mth2-17m13, WORKING DRAFT SEQUENCE, 24
unordered pieces
Length = 91797
Score = 40.1 bits (20), Expect = 0.42
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1048 taatatacatatacatacta 1067
||||||||||||||||||||
Sbjct: 51246 taatatacatatacatacta 51227
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 170,584
Number of Sequences: 392609
Number of extensions: 170584
Number of successful extensions: 12979
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12971
Number of HSP's gapped (non-prelim): 8
length of query: 1191
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1171
effective length of database: 433,880,813
effective search space: 508074432023
effective search space used: 508074432023
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)