BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131612.2.1
(620 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL381590.1|AL381590 MtBC01H02R2 MtBC Medicago truncatula... 54 1e-005
gb|AC152184.1| Medicago truncatula chromosome 7 BAC clone m... 54 1e-005
gb|AC122723.6| Medicago truncatula clone mth2-5i15, complet... 54 1e-005
gb|BI310709.1|BI310709 EST5312459 GESD Medicago truncatula ... 52 6e-005
gb|AL381589.1|AL381589 MtBC01H02F3 MtBC Medicago truncatula... 50 2e-004
gb|AC137603.16| Medicago truncatula clone mth2-14b10, compl... 50 2e-004
emb|CR493732.1| mth2-143K5FM1 BAC end, cultivar Jemalong A1... 44 0.014
gb|AC152887.20| Medicago truncatula clone mth2-91j4, WORKIN... 42 0.055
gb|AC157648.18| Medicago truncatula clone mth2-68d9, comple... 42 0.055
>gb|AL381590.1|AL381590 MtBC01H02R2 MtBC Medicago truncatula cDNA clone MtBC01H02 T7, mRNA
sequence
Length = 548
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 210 atgctgttcaaccaggccttcagcagaggtctgcagatctcccgtatcctgggaggaca 268
|||||||||||||| || |||||||||||| |||| || || ||||| || ||||||||
Sbjct: 305 atgctgttcaaccaagcgttcagcagaggtttgcaaatttctcgtattcttggaggaca 363
Score = 50.1 bits (25), Expect = 2e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 7 ttgtttgcatccttgccttcatgcccactggatgggg 43
|||||||||| |||||||||||||| ||||| |||||
Sbjct: 102 ttgtttgcattcttgccttcatgccaactggttgggg 138
>gb|AC152184.1| Medicago truncatula chromosome 7 BAC clone mte1-61c3, complete sequence
Length = 103090
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 210 atgctgttcaaccaggccttcagcagaggtctgcagatctcccgtatcctgggaggaca 268
|||||||||||||| || |||||||||||| |||| || || ||||| || ||||||||
Sbjct: 10096 atgctgttcaaccaagcgttcagcagaggtttgcaaatttctcgtattcttggaggaca 10154
Score = 50.1 bits (25), Expect = 2e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 7 ttgtttgcatccttgccttcatgcccactggatgggg 43
|||||||||| |||||||||||||| ||||| |||||
Sbjct: 9318 ttgtttgcattcttgccttcatgccaactggttgggg 9354
>gb|AC122723.6| Medicago truncatula clone mth2-5i15, complete sequence
Length = 105353
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 210 atgctgttcaaccaggccttcagcagaggtctgcagatctcccgtatcctgggaggaca 268
|||||||||||||| || |||||||||||| |||| || || ||||| || ||||||||
Sbjct: 81493 atgctgttcaaccaagcgttcagcagaggtttgcaaatttctcgtattcttggaggaca 81551
Score = 50.1 bits (25), Expect = 2e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 7 ttgtttgcatccttgccttcatgcccactggatgggg 43
|||||||||| |||||||||||||| ||||| |||||
Sbjct: 80715 ttgtttgcattcttgccttcatgccaactggttgggg 80751
>gb|BI310709.1|BI310709 EST5312459 GESD Medicago truncatula cDNA clone pGESD8H8 5' end,
mRNA sequence
Length = 591
Score = 52.0 bits (26), Expect = 6e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 7 ttgtttgcatccttgccttcatgcccactggatggggtttgctcctgattgcccaagc 64
|||||||||| |||||||||||||| ||||| ||||| |||| | |||||| |||||
Sbjct: 406 ttgtttgcattcttgccttcatgccaactggttggggaatgctacagattgcacaagc 463
>gb|AL381589.1|AL381589 MtBC01H02F3 MtBC Medicago truncatula cDNA clone MtBC01H02 T3, mRNA
sequence
Length = 502
Score = 50.1 bits (25), Expect = 2e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 7 ttgtttgcatccttgccttcatgcccactggatgggg 43
|||||||||| |||||||||||||| ||||| |||||
Sbjct: 300 ttgtttgcattcttgccttcatgccaactggttgggg 336
>gb|AC137603.16| Medicago truncatula clone mth2-14b10, complete sequence
Length = 109793
Score = 50.1 bits (25), Expect = 2e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 7 ttgtttgcatccttgccttcatgcccactggatgggg 43
|||||||||| |||||||||||||| ||||| |||||
Sbjct: 60498 ttgtttgcattcttgccttcatgccaactggttgggg 60462
>emb|CR493732.1| mth2-143K5FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 687
Score = 44.1 bits (22), Expect = 0.014
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 177 tggttcccgttcgtgtccgagttccagaccaggatgctgttcaaccaggccttcagcaga 236
|||||||| || || || || ||||| |||||| |||| |||||||| || |||||||||
Sbjct: 68 tggttcccatttgtttcagaattccaaaccaggctgctattcaaccaagcattcagcaga 127
Query: 237 gg 238
||
Sbjct: 128 gg 129
>gb|AC152887.20| Medicago truncatula clone mth2-91j4, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 116277
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 18 cttgccttcatgcccactggatggg 42
||||||||||||||| |||||||||
Sbjct: 96205 cttgccttcatgccctctggatggg 96181
>gb|AC157648.18| Medicago truncatula clone mth2-68d9, complete sequence
Length = 84361
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 18 cttgccttcatgcccactggatggg 42
||||||||||||||| |||||||||
Sbjct: 77629 cttgccttcatgccctctggatggg 77653
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 101,251
Number of Sequences: 392609
Number of extensions: 101251
Number of successful extensions: 7067
Number of sequences better than 0.5: 9
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 7041
Number of HSP's gapped (non-prelim): 26
length of query: 620
length of database: 441,732,993
effective HSP length: 19
effective length of query: 601
effective length of database: 434,273,422
effective search space: 260998326622
effective search space used: 260998326622
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)